Ensa (NM_001026212) Mouse Untagged Clone
CAT#: MC207516
Ensa (untagged) - Mouse endosulfine alpha (Ensa), transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700020C18Rik; 2610007F17Rik; AI451924 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207516 representing NM_001026212
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCCAGAAACAAGAAGAAGAAAACCCTGCGGAGGAGACCGGCGAGGAGAAGCAGGATACACAGGAGA AAGAAGGGATTCTCCCTGAGAAAGCTGAGGAGGCAAAGCTAAAGGCCAAATATCCAAGCCTAGGACAAAA GCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGCAAAAGTACTTTGACTCAGGAGACTAC AACATGGCCAAAGCCAAGATGAAGAACAAGCAGCTGCCAAGTGCAGGAGCAGACAAGAACCTGGTGACCG GTGACCACATCCCCACCCCACAGGACCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTGCGGG GTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001026212 |
Insert Size | 354 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001026212.1, NP_001021383.1 |
RefSeq Size | 2276 bp |
RefSeq ORF | 354 bp |
Locus ID | 56205 |
UniProt ID | P60840 |
Gene Summary | Protein phosphatase inhibitor that specifically inhibits protein phosphatase 2A (PP2A) during mitosis. When phosphorylated at Ser-67 during mitosis, specifically interacts with PPP2R2D (PR55-delta) and inhibits its activity, leading to inactivation of PP2A, an essential condition to keep cyclin-B1-CDK1 activity high during M phase. Also acts as a stimulator of insulin secretion by interacting with sulfonylurea receptor (ABCC8), thereby preventing sulfonylurea from binding to its receptor and reducing K(ATP) channel currents (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200510 | Ensa (tGFP-tagged) - Mouse endosulfine alpha (Ensa), transcript variant 2 |
CNY 2850.00 |
|
MR200510 | Ensa (Myc-DDK-tagged) - Mouse endosulfine alpha (Ensa), transcript variant 2 |
CNY 1200.00 |
|
MR200510L3 | Lenti ORF clone of Ensa (Myc-DDK-tagged) - Mouse endosulfine alpha (Ensa), transcript variant 2 |
CNY 4750.00 |
|
MR200510L4 | Lenti ORF clone of Ensa (mGFP-tagged) - Mouse endosulfine alpha (Ensa), transcript variant 2 |
CNY 4750.00 |