E2f6 (NM_033270) Mouse Untagged Clone
CAT#: MC207483
E2f6 (untagged) - Mouse E2F transcription factor 6 (E2f6), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI462434; E2F6a; E2F6b; EMA |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207483 representing NM_033270
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTCAGCAGCGGACGGCGCGGAGACAGCCCAGCCTGCTGGTGGACCCGGCGCAGGAAACGGTGCGCC GGCGTTGCCGAGACCCCATCAACGTGGAAAACCTACTGCCATCAAAAATAAGGATTAATCTAGAAGAAAA TGTACAGTATGTGTCCATGAGAAAAGCTCTGAAAGTGAAGAGGCCCCGGTTTGATGTGTCACTGGTATAC TTAACTCGGAAGTTTATGGATCTCGTCAGATCTGCCCCTGGGGGCATTCTTGACTTAAACAAAGTTGCCA CAAAACTGGGTGTTCGGAAGAGGCGAGTGTATGACATCACCAATGTCTTGGATGGCATCGAACTGGTGGA AAAGAAATCTAAGAACCACATTCGGTGGATAGGATCTGACCTGAACAACTTTGGGGCCGCACCCCAGCAG AAGAAGCTGCAGGCAGAACTCTCCGACCTGTCGGCCATGGAAGACGCCTTGGACGAGTTGATTAAAGATT GTGCTCAGCAACTGTTGGAGTTAACAGATGACAAGGAAAATGAAAGACTAGCGTATGTAACCTATCAGGA TATTCACGGCATTCAAGCTTTCCATGAACAGATTGTCATTGCAGTGAAGGCTCCAGAGGAAACCAGACTG GATGTTCCAGCTCCCAGAGAAGATTCTATCACAGTACATATTAGGAGCACCAAAGGACCCATTGATGTAT ATTTGTGTGAAGTAGAACAGAACCATTCAAATGGTAAAACCAATGATGGAATAGGAGCCTCTCCATCTAA AAGCAGCCATCCACAATGCCCAGAGAAAGAAGACGAGCCTCCTCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_033270 |
Insert Size | 819 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033270.2, NP_150373.2 |
RefSeq Size | 2446 bp |
RefSeq ORF | 819 bp |
Locus ID | 50496 |
UniProt ID | O54917 |
Gene Summary | Inhibitor of E2F-dependent transcription. Binds DNA cooperatively with DP proteins through the E2 recognition site, 5'-TTTC[CG]CGC-3'. Has a preference for the 5'-TTTCCCGC-3' E2F recognition site. E2F6 lacks the transcriptional activation and pocket protein binding domains. Appears to regulate a subset of E2F-dependent genes whose products are required for entry into the cell cycle but not for normal cell cycle progression. May silence expression via the recruitment of a chromatin remodeling complex containing histone H3-K9 methyltransferase activity. Overexpression delays the exit of cells from the S-phase (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the protein-coding transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203627 | E2f6 (tGFP-tagged) - Mouse E2F transcription factor 6 (E2f6) |
CNY 4370.00 |
|
MR203627 | E2f6 (Myc-DDK-tagged) - Mouse E2F transcription factor 6 (E2f6), transcript variant 1 |
CNY 3840.00 |
|
MR203627L3 | Lenti ORF clone of E2f6 (Myc-DDK-tagged) - Mouse E2F transcription factor 6 (E2f6), transcript variant 1 |
CNY 5890.00 |
|
MR203627L4 | Lenti ORF clone of E2f6 (mGFP-tagged) - Mouse E2F transcription factor 6 (E2f6), transcript variant 1 |
CNY 5890.00 |