Timm13 (NM_013895) Mouse Untagged Clone
CAT#: MC207478
Timm13 (untagged) - Mouse translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | D10Ertd378e; Tim9; Timm9 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207478 representing NM_013895
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACAGCGGCTTCGGCTCGGATTTTGGCGGCACGGGTGGCGGGAAGCTGGACCCGGGGGCCATTATGG AGCAGGTGAAAGTGCAGATCGCCGTGGCCAACGCGCAGGAGCTGCTCCAGAGAATGACGGACAAGTGTTT CCGGAAGTGCATCGGGAAGCCCGGGGGCTCCTTGGATAACTCGGAGCAGAAATGCATCGCCATGTGCATG GACCGCTACATGGACGCCTGGAATACCGTGTCCCGCGCCTACAACTCTCGACTGCAGCGGGAACGAGCCA ACATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_013895 |
| Insert Size | 288 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013895.4, NP_038923.1 |
| RefSeq Size | 1225 bp |
| RefSeq ORF | 288 bp |
| Locus ID | 30055 |
| UniProt ID | P62075 |
| Gene Summary | Mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. Also required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space. The TIMM8-TIMM13 complex mediates the import of proteins such as TIMM23, SLC25A12/ARALAR1 and SLC25A13/ARALAR2, while the predominant TIMM9-TIMM10 70 kDa complex mediates the import of much more proteins (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200258 | Timm13 (tGFP-tagged) - Mouse translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13) |
CNY 2850.00 |
|
| MR200258 | Timm13 (Myc-DDK-tagged) - Mouse translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
| MR200258L3 | Lenti ORF clone of Timm13 (Myc-DDK-tagged) - Mouse translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
| MR200258L4 | Lenti ORF clone of Timm13 (mGFP-tagged) - Mouse translocase of inner mitochondrial membrane 13 homolog (yeast) (Timm13), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
