Snf8 (NM_033568) Mouse Untagged Clone

CAT#: MC207474

Snf8 (untagged) - Mouse SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) (Snf8), (10ug)



  "NM_033568" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms D11Moh34
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207474 representing NM_033568
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCACCGGCGCGGGGTGGGAGCTGGCGCCATTGCCAAGAAGAAACTCGCAGAGGCCAAGTATAAGGAGC
GAGGGACTGTCCTGGCTGAGGACCAGCTGGCCCAGATGTCAAAACAGCTGGACATGTTCAAGACCAACCT
AGAAGAATTTGCCAGCAAGCACAAGCAAGAGATCCGGAAGAATCCTGAGTTCCGAGTCCAGTTCCAAGAC
ATGTGTGCAACCATTGGGGTGGATCCCCTGGCCTCTGGAAAAGGCTTTTGGTCTGAGATGCTGGGCGTTG
GGGACTTCTATTATGAACTGGGTGTCCAGATTATTGAAGTGTGCCTGGCCCTCAAACATCGGAATGGAGG
TCTGATAACTCTGGAGGAGCTACATCAGCAGGTGTTAAAAGGAAGGGGCAAGTTTGCTCAGGATGTCAGC
CAAGACGACCTGATCAGGGCCATCAAGAAGCTGAAAGCCCTGGGCACTGGATTCGGCATCATCCCTGTGG
GAGGCACTTACCTCATCCAGTCTGTTCCCGCTGAGCTCAATATGGATCACACTGTTGTGCTGCAGCTGGC
CGAGAAAAACGGGTATGTGACTGTCAGTGAAATCAAAACCAGTCTTAAATGGGAGACGGAGCGAGCACGG
CAAGTGCTGGAACACCTGCTGAAGGAAGGACTGGCCTGGCTGGATCTGCAGGCTCCAGGGGAGGCCCACT
ACTGGCTGCCAGCTCTTTTCACAGATCTCTACTCCCAGGAGATATCAGCTGAGGAGGCCAAAGAAGCCTT
CCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_033568
Insert Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033568.2, NP_291046.1
RefSeq Size 947 bp
RefSeq ORF 777 bp
Locus ID 27681
UniProt ID Q9CZ28
Gene Summary Component of the endosomal sorting complex required for transport II (ESCRT-II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs. The MVB pathway mediates delivery of transmembrane proteins into the lumen of the lysosome for degradation. The ESCRT-II complex is probably involved in the recruitment of the ESCRT-III complex. The ESCRT-II complex may also play a role in transcription regulation by participating in derepression of transcription by RNA polymerase II, possibly via its interaction with ELL. Required for degradation of both endocytosed EGF and EGFR, but not for the EGFR ligand-mediated internalization. Required for the exosomal release of SDCBP, CD63 and syndecan (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...