Ubd (NM_023137) Mouse Untagged Clone
CAT#: MC207459
Ubd (untagged) - Mouse ubiquitin D (Ubd), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | FAT10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207459 representing NM_023137
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTTCTGTCCGCACCTGTGTTGTCCGTTCAGACCAATGGCGGTTAATGACCTTTGAGACCACTGAGA ATGACAAAGTGAAGAAGATAAATGAACATATTAGGTCCCAAACCAAGGTCTCTGTACAGGACCAGATCCT TCTGCTAGACTCCAAAATCCTCAAGCCCCATCGAAAATTGTCATCCTATGGGATTGACAAGGAAACCACT ATCCACCTTACCCTGAAGGTGGTGAAGCCCAGTGATGAAGAGCTGCCCTTGTTTCTGGTGGAGTCCAAAA ACGAGGGGCAAAGGCACCTCCTCCGAGTTCGAAGATCCAGCTCAGTGGCCCAGGTGAAAGAGATGATCGA GAGTGTGACCTCTGTGATCCCTAAGAAGCAGGTTGTGAATTGCAACGGAAAGAAGCTGGAAGATGGAAAG ATCATGGCTGACTACAACATCAAGAGTGGCAGTTTGCTCTTTCTGACAACACACTGCACTGGGGGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023137 |
Insert Size | 489 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023137.3, NP_075626.1 |
RefSeq Size | 947 bp |
RefSeq ORF | 489 bp |
Locus ID | 24108 |
UniProt ID | P63072 |
Gene Summary | Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1-dependent manner. Probably functions as a survival factor. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201267 | Ubd (tGFP-tagged) - Mouse ubiquitin D (Ubd) |
CNY 2850.00 |
|
MR201267 | Ubd (Myc-DDK-tagged) - Mouse ubiquitin D (Ubd) |
CNY 1200.00 |
|
MR201267L3 | Lenti ORF clone of Ubd (Myc-DDK-tagged) - Mouse ubiquitin D (Ubd) |
CNY 4750.00 |
|
MR201267L4 | Lenti ORF clone of Ubd (mGFP-tagged) - Mouse ubiquitin D (Ubd) |
CNY 3600.00 |