Cib1 (NM_011870) Mouse Untagged Clone

CAT#: MC207453

Cib1 (untagged) - Mouse calcium and integrin binding 1 (calmyrin) (Cib1), (10ug)



  "NM_011870" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cibkip; Kip; Prkdcip
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207453 representing NM_011870
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAGGTTCGGGCAGTCGCCTGTCTAAGGAGCTGCTGGCCGAGTACCAGGACCTGACGTTCCTGACCA
AGCAGGAGATCCTCCTAGCCCACAGACGCTTTTGTGAGCTGCTTCCCCCAGAGCAGCGGACCGTGGAGGA
GTCACTGCACACCCGAGTATCGTTTGAGCAGATCCTCAGCCTCCCAGAGCTCAAGGCTAACCCTTTCAAG
GAGCGAATCTGCATGGTCTTCTCCACATCACCTACCAGAGACAGCCTGAGCTTTGAGGACTTCCTGGACC
TCCTGAGTGTCTTCAGTGACACAGCAACCCCAGACATCAAGTCACACTATGCCTTCCGCATCTTTGACTT
TGATGACGATGGAACCCTGGACAGAGAAGACCTGAGCCAGCTTGTGAATTGCCTCACGGGAGAGGGCGAG
GACACTCGGCTCAGTGCTTCTGAGATGAAGCAGCTGATTGACAATATCCTGGAAGAGTCAGACATTGACA
GGGATGGGACCATCAATCTTTCCGAGTTCCAGCATGTCATCTCGCGCTCACCAGACTTTGCCAGCTCCTT
TAAGATTGTCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011870
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011870.5, NP_036000.1
RefSeq Size 1055 bp
RefSeq ORF 576 bp
Locus ID 23991
UniProt ID Q9Z0F4
Gene Summary Calcium-binding protein that plays a role in the regulation of numerous cellular processes, such as cell differentiation, cell division, cell proliferation, cell migration, thrombosis, angiogenesis, cardiac hypertrophy and apoptosis. Involved in bone marrow megakaryocyte differentiation by negatively regulating thrombopoietin-mediated signaling pathway. Participates in the endomitotic cell cycle of megakaryocyte, a form of mitosis in which both karyokinesis and cytokinesis are interrupted. Plays a role in integrin signaling by negatively regulating alpha-IIb/beta3 activation in thrombin-stimulated megakaryocytes preventing platelet aggregation. Up-regulates PTK2/FAK1 activity, and is also needed for the recruitment of PTK2/FAK1 to focal adhesions; it thus appears to play an important role in focal adhesion formation. Positively regulates cell migration on fibronectin in a CDC42-dependent manner, the effect being negatively regulated by PAK1. Functions as a negative regulator of stress activated MAP kinase (MAPK) signaling pathways. Down-regulates inositol 1,4,5-trisphosphate receptor-dependent calcium signaling. Involved in sphingosine kinase SPHK1 translocation to the plasma membrane in a N-myristoylation-dependent manner preventing TNF-alpha-induced apoptosis. Regulates serine/threonine-protein kinase PLK3 activity for proper completion of cell division progression. Plays a role in microtubule (MT) dynamics during neuronal development; disrupts the MT depolymerization activity of STMN2 attenuating NGF-induced neurite outgrowth and the MT reorganization at the edge of lamellipodia. Promotes cardiomyocyte hypertrophy via activation of the calcineurin/NFAT signaling pathway. Stimulates calcineurin PPP3R1 activity by mediating its anchoring to the sarcolemma. In ischemia-induced (pathological or adaptive) angiogenesis, stimulates endothelial cell proliferation, migration and microvessel formation by activating the PAK1 and ERK1/ERK2 signaling pathway. Promotes also cancer cell survival and proliferation. May regulate cell cycle and differentiation of spermatogenic germ cells, and/or differentiation of supporting Sertoli cells.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...