Snrpd1 (NM_009226) Mouse Untagged Clone
CAT#: MC207402
Snrpd1 (untagged) - Mouse small nuclear ribonucleoprotein D1 (Snrpd1), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA407109; AL023031; SMD1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207402 representing NM_009226
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGCTCGTGAGATTTTTGATGAAATTGAGTCATGAAACTGTAACCATTGAATTGAAGAATGGGACAC AAGTCCATGGAACAATCACAGGTGTAGATGTCAGCATGAACACACACCTTAAAGCTGTGAAAATGACCCT GAAGAACAGAGAACCTGTACAGTTGGAAACATTGAGTATTCGAGGCAATAACATTCGGTATTTTATTCTA CCAGACAGCTTACCTCTAGATACACTACTTGTGGATGTTGAACCTAAGGTGAAGTCTAAGAAAAGAGAAG CTGTTGCAGGAAGAGGCCGAGGCCGGGGTAGAGGAAGAGGACGTGGTCGTGGCAGAGGAAGAGGGGGTCC TAGGCGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009226 |
Insert Size | 360 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009226.4, NP_033252.1 |
RefSeq Size | 837 bp |
RefSeq ORF | 360 bp |
Locus ID | 20641 |
UniProt ID | P62315 |
Gene Summary | Plays role in pre-mRNA splicing as core component of the SMN-Sm complex that mediates spliceosomal snRNP assembly and as component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Component of both the pre-catalytic spliceosome B complex and activated spliceosome C complexes. Is also a component of the minor U12 spliceosome. May act as a charged protein scaffold to promote snRNP assembly or strengthen snRNP-snRNP interactions through non-specific electrostatic contacts with RNA.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200559 | Snrpd1 (tGFP-tagged) - Mouse small nuclear ribonucleoprotein D1 (Snrpd1) |
CNY 2850.00 |
|
MR200559 | Snrpd1 (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein D1 (Snrpd1) |
CNY 1200.00 |
|
MR200559L3 | Lenti ORF clone of Snrpd1 (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein D1 (Snrpd1) |
CNY 4750.00 |
|
MR200559L4 | Lenti ORF clone of Snrpd1 (mGFP-tagged) - Mouse small nuclear ribonucleoprotein D1 (Snrpd1) |
CNY 4750.00 |