Snca (NM_001042451) Mouse Untagged Clone
CAT#: MC207399
Snca (untagged) - Mouse synuclein, alpha (Snca), transcript variant 1, (10ug)
CNY 1800.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | alpha-Syn; alphaSYN; NACP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207399 representing NM_001042451
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATGTGTTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAGC AGGGTGTGGCAGAGGCAGCTGGAAAGACAAAAGAGGGAGTCCTCTATGTAGGTTCCAAAACTAAGGAAGG AGTGGTTCATGGAGTGACAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTG GTGACTGGTGTGACAGCAGTCGCTCAGAAGACAGTGGAGGGAGCTGGGAATATAGCTGCTGCCACTGGCT TTGTCAAGAAGGACCAGATGGGCAAGGGTGAGGAGGGGTACCCACAGGAAGGAATCCTGGAAGACATGCC TGTGGATCCTGGCAGTGAGGCTTATGAAATGCCTTCAGAGGAAGGCTACCAAGACTATGAGCCTGAAGCC TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042451 |
Insert Size | 423 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC046764, AAH46764 |
RefSeq Size | 1047 bp |
RefSeq ORF | 423 bp |
Locus ID | 20617 |
UniProt ID | O55042 |
Gene Summary | Neuronal protein that plays several roles in synaptic activity such as regulation of synaptic vesicle trafficking and subsequent neurotransmitter release. Participates as a monomer in synaptic vesicle exocytosis by enhancing vesicle priming, fusion and dilation of exocytotic fusion pores. Mechanistically, acts by increasing local Ca(2+) release from microdomains which is essential for the enhancement of ATP-induced exocytosis. Acts also as a molecular chaperone in its multimeric membrane-bound state, assisting in the folding of synaptic fusion components called SNAREs (Soluble NSF Attachment Protein REceptors) at presynaptic plasma membrane in conjunction with cysteine string protein-alpha/DNAJC5 (PubMed:20798282, PubMed:25246573). This chaperone activity is important to sustain normal SNARE-complex assembly during aging. Plays also a role in the regulation of the dopamine neurotransmission by associating with the dopamine transporter (DAT1) and thereby modulating its activity (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200876 | Snca (Myc-DDK-tagged) - Mouse synuclein, alpha (Snca), transcript variant 1 |
CNY 1800.00 |
|
MR200876L1 | Lenti ORF clone of Snca (Myc-DDK-tagged) - Mouse synuclein, alpha (Snca), transcript variant 1 |
CNY 4200.00 |
|
MR200876L2 | Lenti ORF clone of Snca (mGFP-tagged) - Mouse synuclein, alpha (Snca), transcript variant 1 |
CNY 4200.00 |
|
MR200876L3 | Lenti ORF clone of Snca (Myc-DDK-tagged) - Mouse synuclein, alpha (Snca), transcript variant 1 |
CNY 4200.00 |
|
MR200876L4 | Lenti ORF clone of Snca (mGFP-tagged) - Mouse synuclein, alpha (Snca), transcript variant 1 |
CNY 4200.00 |