Srgn (NM_011157) Mouse Untagged Clone
CAT＃: MC207356
Srgn (untagged) - Mouse serglycin (Srgn), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Prg; Prg1; Sgc |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207356 representing NM_011157
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGGTTCCCGTCGGCAGCAGGCTTGTCCTGGCTCTCGCCTTCGTCCTGGTTTGGGGATCTTCAGTGC AAGGTTATCCTGCTCGGAGAGCCAGGTACCAGTGGGTCCGCTGCAAACCGAATGGCTTTTTTGCGAACTG CATCGAGGAGAAGGGACCACAGTTTGACCTAATAGATGAATCCAATAACATCGGCCCTCCCATGAATAAT CCTGTTTTGATGGAAGGACCCTCAAAAGATTTCATCTCCAATTATGATGACTATGGGTCAGGTTCGGGCT CCGGCTCTGGCTCCGGCTCTGGCTCGGGTTCCGGCTCCGGAAGTGGCTTCCTAGGTGACATGGAATGGGA ATACCAGCCAACAGATGAAAGCAATATTGTCTATTTCAACTATAAGCCTTTTGACAGGATTCTCACTGAG CAAAACCAAGACCAACCAGAAGACGATTTTATTATATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_011157 |
| Insert Size | 459 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_011157.2, NP_035287.1 |
| RefSeq Size | 938 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 19073 |
| UniProt ID | P13609 |
| Gene Summary | Plays a role in formation of mast cell secretory granules and mediates storage of various compounds in secretory vesicles. Required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. Plays a role in localizing neutrophil elastase in azurophil granules of neutrophils. Mediates processing of MMP2. Plays a role in cytotoxic cell granule-mediated apoptosis by forming a complex with granzyme B which is delivered to cells by perforin to induce apoptosis. Regulates the secretion of TNF-alpha and may also regulate protease secretion. Inhibits bone mineralization.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the predominant, but shorter, transcript. It has a transcriptional start site that is internal relative to that of variant 2. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201094 | Srgn (tGFP-tagged) - Mouse serglycin (Srgn) |
CNY 2800.00 |
|
| MR201094 | Srgn (Myc-DDK-tagged) - Mouse serglycin (Srgn) |
CNY 1200.00 |
|
| MR201094L3 | Lenti ORF clone of Srgn (Myc-DDK-tagged) - Mouse serglycin (Srgn) |
CNY 4750.00 |
|
| MR201094L4 | Lenti ORF clone of Srgn (mGFP-tagged) - Mouse serglycin (Srgn) |
CNY 3600.00 |
