Kcnmb1 (NM_031169) Mouse Untagged Clone

CAT#: MC207312

Kcnmb1 (untagged) - Mouse potassium large conductance calcium-activated channel, subfamily M, beta member 1 (Kcnmb1), (10ug)



  "NM_031169" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms BKbeta1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207312 representing NM_031169
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAAGAAGCTGGTGATGGCCCAGAAGCGCGGAGAGACACGAGCCCTCTGCCTGGGAGTGGCAATGG
TAGTGTGTGCTGCCATCACCTACTACGTCCTGGGTACAACTGTGCTGCCCCTCTACCAGAAAAGTGTGTG
GACCCAGGAATCCATATGTCACTTGATTGAAACTAATATCAAGGACCAGGAAGAGCTGGAGGGCAAGAAG
GTGCCCCAGTACCCATGCCTTTGGGTCAATGTATCAGCTGTGGGCAGATGGGCCATGCTGTATCACACGG
AAGACACTCGGGATCAAAACCAACAGTGCTCCTATATCCCCAGGAACCTGGACAACTACCAGACAGCCTT
GGCAGATGTGAAGAAGGTCAGAGCCAATTTCTATAAGCACCATGAATTCTATTGCCTTTCTGCACCTCAA
GTCAACGAGACCAGCGTCGTGTACCAGCGCCTCTACGGGCCCCAAGTCCTCCTCTTCTCCTTCTTCTGGC
CCACCTTCCTGCTGACTGGGGGTCTTCTTCTTATTGCCATGGTGAAGCTCAACAGGTCCCTATCCATCTT
GGCAGCTCAGAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_031169
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC013338, AAH13338
RefSeq Size 1199 bp
RefSeq ORF 576 bp
Locus ID 16533
UniProt ID Q8CAE3
Gene Summary Regulatory subunit of the calcium activated potassium KCNMA1 (maxiK) channel. Modulates the calcium sensitivity and gating kinetics of KCNMA1, thereby contributing to KCNMA1 channel diversity. Increases the apparent Ca(2+)/voltage sensitivity of the KCNMA1 channel. It also modifies KCNMA1 channel kinetics and alters its pharmacological properties. It slows down the activation and the deactivation kinetics of the channel. Acts as a negative regulator of smooth muscle contraction by enhancing the calcium sensitivity to KCNMA1. Its presence is also a requirement for internal binding of the KCNMA1 channel opener dehydrosoyasaponin I (DHS-1) triterpene glycoside and for external binding of the agonist hormone 17-beta-estradiol (E2). Increases the binding activity of charybdotoxin (CTX) toxin to KCNMA1 peptide blocker by increasing the CTX association rate and decreasing the dissociation rate.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...