Fnbp1 (NM_019406) Mouse Untagged Clone

CAT#: MC207279

Fnbp1 (untagged) - Mouse formin binding protein 1 (Fnbp1), transcript variant 2, (10ug)



  "NM_019406" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Fnbp1 Antibody - N-terminal region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110057E06Rik; 2210010H06Rik; FBP1; Fbp17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207279 representing NM_019406
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTGGGGCACTGAGCTCTGGGATCAGTTTGACAACTTGGAAAAACATACACAGTGGGGAATCGATA
TTCTTGAGAAATACATCAAGTTTGTCAAGGAGAGGACGGAGATTGAGCTCAGCTATGCCAAGCAACTCAG
GAATCTTTCAAAGAAATACCAACCTAAGAAGAACTCGAAGGAAGAGGAGGAGTACAAGTACACGGCTTGC
AAAGCCTTTCTTTCCACCCTGAATGAGATGAATGACTACGCCGGGCAGCACGAGGTCATCTCTGAGAACA
TGACGTCACAGATCACGGTGGACCTGATGCGCTACGTTCAGGAGCTGAAGCAGGAGAGGAAATCGAACTT
CCATGATGGACGGAAGGCTCAGCAGCACATAGAAACGTGTTGGAAGCAACTGGAGTCAAGTAAGAGGAGG
TTTGAGCGGGACTGTAAGGAAGCCGACCGGGCACAGCAGTACTTCGAGAAAATGGACGCTGACATCAACG
TGACCAAGGCGGATGTGGAAAAGGCACGACAACAAGCTCAGATACGCCAGCAAATGGCAGAGGACAGCAA
AGCAGATTACTCCTTAATCCTGCAGAGATTCAACCAGGAGCAATGGGAATACTACCATACCCACATCCCC
AACATCTTCCAGAAAATACAAGAGATGGAGGAGAGGCGGATTGTGCGTATTGGGGAGTCCATGAAGACGT
ACGCAGAGGTGGACCGGCAGGTGATACCCATCATCGGGAAGTGCCTGGACGGGATAGTGAAGGCGGCCGA
GTCTATCGACCAGAAAAACGACTCCCAGCTGGTCGTAGAAGCCTATAAGTCAGGATTCGAGCCTCCTGGA
GACATTGAATTCGAAGATTACACACAGCCAATGAAACGCACAGTGTCAGACAACAGCCTTTCCAGCTCCA
AAGAAGGCAAGCCTGAGCTCAGATTTGGCGGCAAGTCCAGAGGCAAGCTCTGGCCATTCATCAAGAAAAA
CAAGGTACTGGCCATTTGGACCCTGCGTGGGCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_019406
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_019406.3, NP_062279.1
RefSeq Size 1983 bp
RefSeq ORF 1017 bp
Locus ID 14269
UniProt ID Q80TY0
Gene Summary Required to coordinate membrane tubulation with reorganization of the actin cytoskeleton during the late stage of clathrin-mediated endocytosis. Binds to lipids such as phosphatidylinositol 4,5-bisphosphate and phosphatidylserine and promotes membrane invagination and the formation of tubules. Also enhances actin polymerization via the recruitment of WASL/N-WASP, which in turn activates the Arp2/3 complex. Actin polymerization may promote the fission of membrane tubules to form endocytic vesicles. May act as a link between RND2 signaling and regulation of the actin cytoskeleton. May be required for the lysosomal retention of FASLG/FASL (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses a different segment for its 3' coding region and UTR, compared to variant 3. The resulting protein (isoform b) has a different and shorter C-terminus when it is compared to isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...