Crk (NM_133656) Mouse Untagged Clone

CAT#: MC207252

Crk (untagged) - Mouse v-crk sarcoma virus CT10 oncogene homolog (avian) (Crk), (10ug)



  "NM_133656" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms c-Crk; Cr; Crk-I; Crk-II; Crk-III; Crk3; CrkIII; Crko; p38
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207252 representing NM_133656
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGCCGCCTGAGCCGGCAGGAGGCGG
TGGCGCTATTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTA
TGTGCTTAGCGTCTCCGAAAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCTCCA
GTGCCTCCGTCGCCCGCTCAGCCTCCGCCGGGAGTGAGTCCCTCCAGGCTCCGAATAGGAGATCAAGAAT
TTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACATTGATAGAACC
AGTGGCCAGATCAAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCAGAGTATGTGCGGGCCCTC
TTTGACTTTAATGGGAATGATGAAGAAGATCTTCCCTTTAAGAAAGGAGACATCCTGAGAATCCGGGATA
AGCCTGAAGAGCAGTGGTGGAATGCAGAGGACAGCGAAGGAAAGAGGGGGATGATTCCTGTCCCTTACGT
GGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTAACCAGGAGGGTTCCCACCCA
CAGCCACTGGGTGGGCCGGAGCCTGGGCCCTATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCC
AGAATGGGCCCATTTATGCCAGGGTTATCCAGAAGCGAGTCCCTAATGCCTACGACAAGACAGCCTTGGC
TTTGGAGGTCGGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGATGAGGACTTCA
GCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133656
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_133656.5, NP_598417.2
RefSeq Size 6005 bp
RefSeq ORF 915 bp
Locus ID 12928
UniProt ID Q64010
Gene Summary This gene is part of a family of adapter proteins that mediate formation of signal transduction complexes in response to extracellular stimuli, such as growth and differentiation factors. Protein-protein interactions occur through the SH2 domain, which binds phosphorylated tyrosine residues, and the SH3 domain, which binds proline-rich peptide motifs. These interactions promote recruitment and activation of effector proteins to regulate cell migration, adhesion, and proliferation. In mouse this protein is essential for embryonic development. Alternatively spliced transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (2) includes an alternate segment, compared to variant 1, resulting in a longer protein (isoform 2, also known as CrkII) that has a distinct C-terminus and an additional SH3 domain, compared to isoform 1 (CrkI). Isoform 2 (CrkII) is proposed to have a negative regulatory role. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...