Tspo (NM_009775) Mouse Untagged Clone
CAT#: MC207241
Tspo (untagged) - Mouse translocator protein (Tspo), (10ug)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Bzrp; IBP; PBR; Tspo1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_009775, the custom clone sequence may differ by one or more nucleotides
ATGCCTGAATCCTGGGTGCCTGCCGTGGGCCTCACTCTGGTGCCCAGCCTGGGGGGCTTCATGGGAGCCT ACTTTGTACGTGGCGAGGGCCTCCGGTGGTATGCTGGCTTGCAGAAACCCTCTTGGCATCCGCCTCGCTG GACACTGGCTCCCATCTGGGGCACACTGTATTCAGCCATGGGGTATGGCTCCTACATAGTCTGGAAAGAG CTGGGAGGTTTCACAGAGGACGCTATGGTTCCCTTGGGTCTCTACACTGGTCAGCTGGCTCTGAACTGGG CGTGGCCCCCCATCTTCTTTGGTGCCCGGCAGATGGGCTGGGCCTTGGCCGATCTTCTGCTTGTCAGTGG GGTGGCGACTGCCACAACCCTGGCTTGGCACCGAGTGAGCCCGCCGGCTGCCCGCTTGCTGTACCCTTAC CTGGCCTGGCTGGCTTTTGCCACCGTGCTCAACTACTATGTATGGCGTGATAACTCTGGCCGGCGAGGGG GCTCCCGGCTCGCAGAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009775 |
Insert Size | 510 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC002055, AAH02055 |
RefSeq Size | 825 bp |
RefSeq ORF | 510 bp |
Locus ID | 12257 |
UniProt ID | P50637 |
Gene Summary | Can bind protoporphyrin IX and may play a role in the transport of porphyrins and heme (By similarity). Was initially identified as peripheral-type benzodiazepine receptor; can also bind isoquinoline carboxamides. Promotes the transport of cholesterol across mitochondrial membranes and may play a role in lipid metabolism (PubMed:9832438, PubMed:24814875), but its precise physiological role is controversial. According to some reports, it is not required for steroid hormone biosynthesis (PubMed:24174323, PubMed:24936060).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201408 | Tspo (tGFP-tagged) - Mouse translocator protein (Tspo) |
CNY 5200.00 |
|
MR201408 | Tspo (Myc-DDK-tagged) - Mouse translocator protein (Tspo) |
CNY 3600.00 |
|
MR201408L3 | Lenti ORF clone of Tspo (Myc-DDK-tagged) - Mouse translocator protein (Tspo) |
CNY 4750.00 |
|
MR201408L4 | Lenti ORF clone of Tspo (mGFP-tagged) - Mouse translocator protein (Tspo) |
CNY 4750.00 |