Myo3b (BC034907) Mouse Untagged Clone
CAT＃: MC207189
Myo3b (untagged) - Mouse myosin IIIB (cDNA clone IMAGE:1380182), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A430065P19Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207189 representing BC034907
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATGAGGAGATTGAGGCTGAATACAACATTCTGCAGTTTCTCCCCAGCCATCCCAACGTTGTAAAGT TTTATGGGATGTTTTACAAAGCCGATCGCTGTGTGGGAGGACAGCTATGGCTGGTTCTGGAGCTGTGTAA TGGGGGCTCTGTCACTGAGCTTGTCAAGGGCCTTCTGAGGTGCGGCAAGAGGCTGGACGAAGCTGTGATT TCCTACATTCTGTATGGAGCCCTCTTGGGCCTTCAGCATTTGCACTGCCACCGAATCATCCACCGAGATG TGAAGGGGAATAACATTCTTCTGACGACAGAAGGAGGAGTTAAGCTCGTTGACTTTGGTGTCTCTGCTCA ACTTACAAGCACACGGCTGCGGAGAAACACATCAGTTGGGACCCCATTCTGGATGGCTCCTGAGGTCATT GCTTGCGAGCAGCAGTATGACTCGTCCTATGACGCTCGTTGTGACGTCTGGTCCTTGGGCATCACAGCCA TTGAGCTGGGAGATGGAGACCCTCCCCTCTTTGAAATGCATCCTGTGAAAATGCTCTTTAAGATACCAAG CATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC034907 |
| Insert Size | 567 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC034907.1 |
| RefSeq Size | 1363 bp |
| RefSeq ORF | 566 bp |
| Locus ID | 329421 |
| Gene Summary | Probable actin-based motor with a protein kinase activity (By similarity). Required for normal cochlear hair bundle development and hearing. Plays an important role in the early steps of cochlear hair bundle morphogenesis. Influences the number and lengths of stereocilia to be produced and limits the growth of microvilli within the forming auditory hair bundles thereby contributing to the architecture of the hair bundle, including its staircase pattern (PubMed:26754646). Involved in the elongation of actin in stereocilia tips by transporting the actin regulatory factor ESPN to the plus ends of actin filaments (PubMed:22264607).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201775 | Myo3b (tGFP-tagged) - Mouse myosin IIIB (cDNA clone IMAGE:1380182) |
CNY 2090.00 |
|
| MR201775 | Myo3b (Myc-DDK-tagged) - Mouse myosin IIIB (cDNA clone IMAGE:1380182) |
CNY 1900.00 |
|
| MR201775L3 | Lenti ORF clone of Myo3b (Myc-DDK-tagged) - Mouse myosin IIIB (cDNA clone IMAGE:1380182) |
CNY 3800.00 |
|
| MR201775L4 | Lenti ORF clone of Myo3b (mGFP-tagged) - Mouse myosin IIIB (cDNA clone IMAGE:1380182) |
CNY 3800.00 |
