Jazf1 (NM_001168277) Mouse Untagged Clone
CAT#: MC207175
Jazf1 (untagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2, (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI591476; C820002C15; Jaz1; Tip27 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207175 representing NM_001168277
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACAGATGCTGCACGCCGAGAACAGGAATCTCTGAAGAAGAAGATTCAGCCGAAGCTTTCACTAACCC TGTCCAGCTCCGTGTCTCGAGGGAATGTGTCCACTCCACCTCGACATAGCAGTGGCAGCCTTACTCCCCC TGTGACCCCGCCCATCACGCCCTCCTCTTCATTCCGCAGCAGCACTCCAACAGGCAGCGAGTATGATGAG GAAGAGGTGGACTATGAGGAGTCAGACAGTGATGAGTCCTGGACCACAGAGAGCGCCATCAGCTCTGAAG CAATCCTCAGCTCCATGTGCATGAATGGAGGGGAAGAGAAGCCTTTCGCCTGCCCAGTTCCAGGGTGTAA AAAGAGATACAAGAATGTGAATGGCATAAAGTACCATGCTAAGAATGGTCACCGAACACAGATTCGCGTC CGCAAACCATTCAAATGCCGGTGTGGGAAGAGTTACAAGACAGCTCAGGGCCTGCGGCACCACACAATCA ATTTCCATCCCCCAGTGTCTGCCGAGATGATCAGGAAGATGCAGCAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001168277 |
Insert Size | 540 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001168277.1, NP_001161749.1 |
RefSeq Size | 2926 bp |
RefSeq ORF | 540 bp |
Locus ID | 231986 |
UniProt ID | Q80ZQ5 |
Gene Summary | Acts as a transcriptional corepressor of orphan nuclear receptor NR2C2 (By similarity). Inhibits expression of the gluconeogenesis enzyme PCK2 through inhibition of NR2C2 activity (PubMed:24380856). Also involved in transcriptional activation of NAMPT by promoting expression of PPARA and PPARD (PubMed:24930994). Plays a role in lipid metabolism by suppressing lipogenesis, increasing lipolysis and decreasing lipid accumulation in adipose tissue (PubMed:24380856, PubMed:25614086). Plays a role in glucose homeostasis by improving glucose metabolism and insulin sensitivity (PubMed:25614086, PubMed:24380856).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201591 | Jazf1 (Myc-DDK-tagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2 |
CNY 2400.00 |
|
MR201591L3 | Lenti ORF clone of Jazf1 (Myc-DDK-tagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2 |
CNY 4750.00 |
|
MR201591L4 | Lenti ORF clone of Jazf1 (mGFP-tagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2 |
CNY 4750.00 |