Sfrs8 (BC034336) Mouse Untagged Clone
CAT#: MC207174
Sfrs8 (untagged) - Mouse splicing factor, arginine/serine-rich 8 (cDNA clone IMAGE:5361562), (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1190005N23Rik; 6330437E22Rik; AI197402; AW212079; Sfrs8; Srsf8; SWAP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207174 representing BC034336
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTACGGTGCCGGCGGGGGCCGTGCCAAGCCGGAGAGGAAAGGCGGAGTGAAGGAGGAGGCCGGGCCGG GCGGCACCGGCACTGGGGGCAACCGGGTGGAGCTTCTGGTTTTCGGCTATGCCTGCAAGTTGTTCCGCGA CGACGAGCGGGCTTTGGCCCAGGAACAGGGACAGCACCTCATCCCCTGGATGGGGGACCCCAAGATCCTC ATCGACAGGTCGGTTCCTCCCCCCACCCGTCGACCCTCCCCTCCCTCGCCCGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC034336 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC034336.1 |
RefSeq Size | 1806 bp |
RefSeq ORF | 266 bp |
Locus ID | 231769 |
Gene Summary | Plays a role as an alternative splicing regulator. Regulates its own expression at the level of RNA processing. Also regulates the splicing of fibronectin and CD45 genes. May act, at least in part, by interaction with other R/S-containing splicing factors. Represses the splicing of MAPT/Tau exon 10 (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200205 | Sfrs8 (tGFP-tagged) - Mouse splicing factor, arginine/serine-rich 8 (cDNA clone IMAGE:5361562) |
CNY 2090.00 |
|
MR200205 | Sfrs8 (Myc-DDK-tagged) - Mouse splicing factor, arginine/serine-rich 8 (cDNA clone IMAGE:5361562) |
CNY 1900.00 |
|
MR200205L3 | Lenti ORF clone of Sfrs8 (Myc-DDK-tagged) - Mouse splicing factor, arginine/serine-rich 8 (cDNA clone IMAGE:5361562) |
CNY 3800.00 |
|
MR200205L4 | Lenti ORF clone of Sfrs8 (mGFP-tagged) - Mouse splicing factor, arginine/serine-rich 8 (cDNA clone IMAGE:5361562) |
CNY 3800.00 |