Ten1 (NM_027107) Mouse Untagged Clone
CAT＃: MC207116
Ten1 (untagged) - Mouse RIKEN cDNA 2310004N24 gene (2310004N24Rik), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310004N24Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207116 representing NM_027107
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGCCTAAGCCTGGGGTCTATTACTTTCCCTGGGAGGTCAGTGACGGCCATGTCCCCGAAGGAAGCA CACTGCGAACATTTGGCAGGTTGTATCTCTATGACATGGCACGCTCCCTCATGACCCTGGCAGCTCCGCA GAAACCTGATCAGTGTCAACTGCTTGTCTGCACCAACTTGGTGGAGCCTTTTGAGGCACATGTGAACTTC CTGTACATGGTTCTTGGGGACCTGGAGCGAATGGAGGGTGGAGCTTTTGTGGTGAGGGCCCGACTGCTCA CCTGTGTGGAGGGGATGGATTTGTCCCTGTTAGAGAAAGCCATCTTGGAGCAGAGGCGTCACCTGCAGAA GAGGCAGCAGCCAATAGGAGACGCCAGCACCTTGCAAACCCCTACACCTGCTCCTCAATCGATTCCCAGT GACAGCCTTAGTCTGGAACCAGAGAACAGGGGGCAGCAGGTGCCCCTTCCCCAAACTCTGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_027107 |
| Insert Size | 486 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_027107.1, NP_081383.1 |
| RefSeq Size | 919 bp |
| RefSeq ORF | 486 bp |
| Locus ID | 69535 |
| UniProt ID | Q9D7K2 |
| Gene Summary | Component of the CST complex proposed to act as a specialized replication factor promoting DNA replication under conditions of replication stress or natural replication barriers such as the telomere duplex. The CST complex binds single-stranded DNA with high affinity in a sequence-independent manner, while isolated subunits bind DNA with low affinity by themselves. Initially the CST complex has been proposed to protect telomeres from DNA degradation (PubMed:19854130). However, the CST complex has been shown to be involved in several aspects of telomere replication. The CST complex inhibits telomerase and is involved in telomere length homeostasis; it is proposed to bind to newly telomerase-synthesized 3' overhangs and to terminate telomerase action implicating the association with the ACD:POT1 complex thus interfering with its telomerase stimulation activity. The CST complex is also proposed to be involved in fill-in synthesis of the telomeric C-strand probably implicating recruitment and activation of DNA polymerase alpha. The CST complex facilitates recovery from many forms of exogenous DNA damage; seems to be involved in the re-initiation of DNA replication at repaired forks and/or dormant origins (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR201257 | Ten1 (Myc-DDK-tagged) - Mouse RIKEN cDNA 2310004N24 gene (2310004N24Rik) |
CNY 1200.00 |
|
| MR201257L3 | Lenti ORF clone of Ten1 (Myc-DDK-tagged) - Mouse RIKEN cDNA 2310004N24 gene (2310004N24Rik) |
CNY 4750.00 |
|
| MR201257L4 | Lenti ORF clone of Ten1 (mGFP-tagged) - Mouse RIKEN cDNA 2310004N24 gene (2310004N24Rik) |
CNY 4750.00 |
