Rbm38 (BC006687) Mouse Untagged Clone
CAT#: MC207081
Rbm38 (untagged) - Mouse RNA binding motif protein 38 (cDNA clone MGC:6122 IMAGE:3582604), (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Rnpc1; Seb4; Seb4l |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC006687
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGATCGGGCAGCGGCTGATAGGGCTTGCAAAGACCCTAACCCTATCATCGATGGTCGCAAGGCCA ATGTGAACCTGGCCTACCTGGGTGCCAAGCCTAGGAGCTTACAGACGGGCTTTGCTGTTGGTGTGCAGCA ACTACACCCCACCTTGATCCAGCGCACCTACGGGCTGACTCCTCACTACATCTACCCACCAGCCATTGTG CAGCCCAGCGTGGTGATCCCTGCCACCCCTGTCCCGTCACTGTCCTCGCCCTACCTTGAGTATACACCAG CCAGCCCAGCCTACGCCCAGTACCCGCCAGCCACTTACGACCAGTACCCATATGCTGCCTCACCTGCTGC AGCCACCAGCTTCGTGGGCTACGGCTACCCTGCTGCCGTGCCCCAAGCCTTGTCTGCTGCTGCACCTGCA GGCACCACCTTCGTGCAGTACCAGGCACCTCAGCTACAGCCTGACAGGATGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC006687 |
Insert Size | 1749 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC006687 |
RefSeq Size | 2308 bp |
RefSeq ORF | 476 bp |
Locus ID | 56190 |
Gene Summary | RNA-binding protein that specifically bind the 3' UTR of CDKN1A transcripts, leading to maintain the stability of CDKN1A transcripts, thereby acting as a mediator of the p53/TP53 family to regulate CDKN1A. CDKN1A is a cyclin-dependent kinase inhibitor transcriptionally regulated by the p53/TP53 family to induce cell cycle arrest. Has the ability to induce cell cycle arrest in G1 and maintain the stability of CDKN1A transcripts induced by p53/TP53. Also acts as a mRNA splicing factor. Specifically regulates the expression of FGFR2-IIIb, an epithelial cell-specific isoform of FGFR2 (By similarity). Plays a role in myogenic differentiation.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201195 | Rbm38 (tGFP-tagged) - Mouse RNA binding motif protein 38 (cDNA clone MGC:6122 IMAGE:3582604) |
CNY 2,090.00 |
|
MR201195 | Rbm38 (Myc-DDK-tagged) - Mouse RNA binding motif protein 38 (cDNA clone MGC:6122 IMAGE:3582604) |
CNY 1,900.00 |
|
MR201195L3 | Lenti ORF clone of Rbm38 (Myc-DDK-tagged) - Mouse RNA binding motif protein 38 (cDNA clone MGC:6122 IMAGE:3582604) |
CNY 3,800.00 |
|
MR201195L4 | Lenti ORF clone of Rbm38 (mGFP-tagged) - Mouse RNA binding motif protein 38 (cDNA clone MGC:6122 IMAGE:3582604) |
CNY 3,800.00 |