Bet1l (BC019730) Mouse Untagged Clone

CAT#: MC207080

Bet1l (untagged) - Mouse blocked early in transport 1 homolog (S, (10ug)



  "BC019730" in other vectors (4)

CNY 3230.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610021K23Rik; Gs15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC019730
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGATTGGACTCGAGCTCAGAGCTCTGGTGCTGTGGAGGACATTCTGGACAGAGAGAACAAGCGGA
TGGCTGACAGCCTGGCCTCCAAGGTGACCAGGCTTAAATCGGTCAGTGGTGGCCCTCTTCCCTTCCGTGA
GATACTTTGGTGGGTGGGGCTGAGAGGGGAGGAAGGAGGCCGTGTGCTGTCTGTGGGCATTGCTGACTGG
AGAAGTGCTTCAGGTAATAACTTGGCCTTTTTTTTAGCTTTCTCTGGTAATAGGTACTTTTCAGAGTCGT
GGGTAAAATGTAGCTGGTCTGAAGGGAAGGTGGGCACTACTCTCTGTGGCTTTGCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC019730
Insert Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC019730, AAH19730
RefSeq Size 719 bp
RefSeq ORF 338 bp
Locus ID 54399
Gene Summary Vesicle SNARE required for targeting and fusion of retrograde transport vesicles with the Golgi complex. Required for the integrity of the Golgi complex (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...