Myl1 (BC059087) Mouse Untagged Clone
CAT＃: MC207061
Myl1 (untagged) - Mouse myosin, light polypeptide 1 (cDNA clone MGC:70067 IMAGE:30139109), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MLC1f, MLC3f |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC059087
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCTTCAGTGCTGACCAGATTGCCGACTTCAAGGAGGCATTTCTCCTGTTTGACAGAACAGGTGAAT GCAAGATCACCTTAAGTCAGGTGGGAGACGTCCTCCGGGCTCTGGGCACCAATCCCACCAATGCAGAGGT CAAGAAGGTTCTTGGGAACCCCAGCAATGAAGAGATGAATGCTAAGAAAATCGAGTTTGAACAGTTTCTG CCCATGATGCAAGCTATCTCCAACAACAAGGACCAGGGAGGTTATGAAGATTTCGTTGAGGGTCTGCGTG TCTTCGACAAGGAGGGCAATGGCACCGTCATGGGTGCTGAACTCCGCCATGTCCTCGCCACTCTGGGAGA GAAGATGAAGGAGGAAGAGGTAGAAGCGTTGCTGGCAGGCCAGGAGGACTCCAATGGCTGCATCAACTAT GAAGGTACAGCCAGCCTCACCTCATTAAGGAGAGATTCATTTTCAACTTTATTTTCCTCTTCTCTATTGA CATATATGACTTATTATAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC059087 |
| Insert Size | 513 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC059087, AAH59087 |
| RefSeq Size | 649 bp |
| RefSeq ORF | 512 bp |
| Locus ID | 17901 |
| Gene Summary | Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two non-phosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in fast skeletal muscle. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201424 | Myl1 (tGFP-tagged) - Mouse myosin, light polypeptide 1 (cDNA clone MGC:70067 IMAGE:30139109) |
CNY 2090.00 |
|
| MR201424 | Myl1 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 1 (cDNA clone MGC:70067 IMAGE:30139109) |
CNY 1900.00 |
|
| MR201424L3 | Lenti ORF clone of Myl1 (Myc-DDK-tagged) - Mouse myosin, light polypeptide 1 (cDNA clone MGC:70067 IMAGE:30139109) |
CNY 3800.00 |
|
| MR201424L4 | Lenti ORF clone of Myl1 (mGFP-tagged) - Mouse myosin, light polypeptide 1 (cDNA clone MGC:70067 IMAGE:30139109) |
CNY 3800.00 |
