Eif5a (NM_001166596) Mouse Untagged Clone
CAT#: MC207032
Eif5a (untagged) - Mouse eukaryotic translation initiation factor 5A (Eif5a), transcript variant 9, (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA410058; D19Wsu54; D19Wsu54e; eIF-4D; eIF-5A; eIF-5A-1; eIF-5A1; Eif4d; Eif5a1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207032 representing NM_001166596
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGATGATTTGGACTTCGAGACAGGAGATGCAGGGGCCTCAGCCACCTTCCCAATGCAGTGCTCAG CATTACGTAAGAATGGTTTTGTGGTGCTCAAAGGCCGGCCATGTAAGATCGTCGAGATGTCTACTTCGAA GACTGGCAAGCATGGCCATGCCAAGGTCCATCTGGTTGGCATTGACATTTTTACTGGGAAGAAATATGAA GATATCTGCCCGTCAACTCATAATATGGATGTCCCCAACATCAAACGGAATGACTTCCAGCTGATTGGCA TCCAGGATGGGTACCTATCCCTGCTCCAGGACAGTGGGGAGGTACGAGAGGACCTTCGTCTGCCTGAAGG AGACCTTGGCAAGGAGATTGAGCAGAAGTATGACTGTGGAGAAGAGATCCTGATCACAGTGCTGTCTGCC ATGACAGAGGAGGCAGCTGTTGCAATCAAGGCCATGGCAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166596 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001166596.1, NP_001160068.1 |
RefSeq Size | 1293 bp |
RefSeq ORF | 465 bp |
Locus ID | 276770 |
UniProt ID | P63242 |
Gene Summary | This gene encodes an elongation initiation factor, which participates in protein synthesis. The encoded protein also plays roles in mRNA metabolism, cell proliferation, and cell cycle control. This protein contains a modified lysine residue called hypusine, which appears to be necessary for its function. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2, 5, and 19. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (9) differs in the 5' UTR compared to variant 1. Variants 1-9 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226080 | Eif5a (tGFP-tagged) - Mouse eukaryotic translation initiation factor 5A (Eif5a) transcript variant 9, (10ug) |
CNY 2850.00 |
|
MR226080 | Eif5a (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 5A (Eif5a), transcript variant 9 |
CNY 1200.00 |
|
MR226080L3 | Lenti ORF clone of Eif5a (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 5A (Eif5a), transcript variant 9 |
CNY 4750.00 |
|
MR226080L4 | Lenti ORF clone of Eif5a (mGFP-tagged) - Mouse eukaryotic translation initiation factor 5A (Eif5a), transcript variant 9 |
CNY 4750.00 |