Vegfb (NM_001185164) Mouse Untagged Clone
CAT#: MC207023
Vegfb (untagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2, (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | VEGF-B; Vrf |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC207023 representing NM_001185164.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCCCCCTGCTCCGTCGCCTGCTGCTTGTTGCACTGCTGCAGCTGGCTCGCACCCAGGCCCCTGTG TCCCAGTTTGATGGCCCCAGCCACCAGAAGAAAGTGGTGCCATGGATAGACGTTTATGCACGTGCCACA TGCCAGCCCAGGGAGGTGGTGGTGCCTCTGAGCATGGAACTCATGGGCAATGTGGTCAAACAACTAGTG CCCAGCTGTGTGACTGTGCAGCGCTGTGGTGGCTGCTGCCCTGACGATGGCCTGGAATGTGTGCCCACT GGGCAACACCAAGTCCGAATGCAGATCCTCATGATCCAGTACCCGAGCAGTCAGCTGGGGGAGATGTCC CTGGAAGAACACAGCCAATGTGAATGCAGACCAAAAAAAAAGGAGAGTGCTGTGAAGCCAGACAGCCCC AGGATCCTCTGCCCGCCTTGCACCCAGCGCCGTCAACGCCCTGACCCCCGGACCTGCCGCTGCCGCTGC AGACGCCGCCGCTTCCTCCATTGCCAAGGGCGGGGCTTAGAGCTCAACCCAGACACCTGTAGGTGCCGG AAGCCGCGAAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001185164 |
| Insert Size | 567 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001185164.1 |
| RefSeq Size | 1197 bp |
| RefSeq ORF | 567 bp |
| Locus ID | 22340 |
| UniProt ID | P49766 |
| MW | 21.4 kDa |
| Gene Summary | Growth factor for endothelial cells. VEGF-B167 binds heparin and neuropilin-1 whereas the binding to neuropilin-1 of VEGF-B186 is regulated by proteolysis. VEGF-B seems to be required for normal heart function in adult but is not required for proper development of the cardiovascular system either during development or for angiogenesis in adults.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. This difference results in a frameshift and an isoform (Vegf-b167) with a shorter and distinct C-terminus, compared to isoform Vegf-b186. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR201768 | Vegfb (Myc-DDK-tagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2 |
CNY 1900.00 |
|
| MR201768L3 | Lenti ORF clone of Vegfb (Myc-DDK-tagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2 |
CNY 3800.00 |
|
| MR201768L4 | Lenti ORF clone of Vegfb (mGFP-tagged) - Mouse vascular endothelial growth factor B (Vegfb), transcript variant 2 |
CNY 3800.00 |
