Cflar (BC023121) Mouse Untagged Clone
CAT#: MC207022
Cflar (untagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551), (10ug)
CNY 4920.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | MRIT, CLARP, FLAME, Casper, I-FLICE, Flip |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for BC023121, the custom clone sequence may differ by one or more nucleotides
ATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATG GTGGCTCACAACCATCTGTAACAAGATCTGACTCCCTCTTCTGGAGTGTCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC023121 |
| Insert Size | 2015 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC023121 |
| RefSeq Size | 2019 bp |
| RefSeq ORF | 2015 bp |
| Locus ID | 12633 |
| Gene Summary | Apoptosis regulator protein which may function as a crucial link between cell survival and cell death pathways in mammalian cells. Acts as an inhibitor of TNFRSF6 mediated apoptosis. A proteolytic fragment (p43) is likely retained in the death-inducing signaling complex (DISC) thereby blocking further recruitment and processing of caspase-8 at the complex. Full length and shorter isoforms have been shown either to induce apoptosis or to reduce TNFRSF-triggered apoptosis. Lacks enzymatic (caspase) activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200009 | Cflar (tGFP-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
CNY 2850.00 |
|
| MR200009 | Cflar (Myc-DDK-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
CNY 1200.00 |
|
| MR200009L3 | Lenti ORF clone of Cflar (Myc-DDK-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
CNY 3600.00 |
|
| MR200009L4 | Lenti ORF clone of Cflar (mGFP-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
CNY 4750.00 |
