Ptp4a3 (NM_008975) Mouse Untagged Clone
CAT#: MC207014
Ptp4a3 (untagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2, (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AV088979; pPtp4a3; Prl-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207014 representing NM_008975.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCGCATGAACCGGCCTGCGCCTGTGGAGGTGAGCTACCGGCACATGCGCTTCCTCATCACCCAC AACCCCAGCAATGCCACCCTCAGCACGTTCATCGAGGACCTGAAGAAGTACGGGGCTACCACTGTGGTG CGCGTGTGTGAAGTGACCTATGACAAGACCCCCCTGGAGAAGGACGGCATCACTGTTGTGGACTGGCCC TTTGATGATGGAGCGCCCCCTCCTGGCAAAGTGGTAGAGGACTGGCTGAGCCTGCTGAAGGCCAAGTTC TACAATGACCCGGGAAGCTGCGTAGCTGTGCACTGTGTGGCGGGCCTGGGAAGGGCCCCAGTGCTCGTG GCTCTCGCCCTCATCGAGAGCGGGATGAAGTACGAGGACGCCATCCAGTTCATCCGACAGAAGCGCCGT GGGGCCATCAACAGCAAGCAGCTCACCTACCTGGAGAAGTACCGGCCTAAGCAGAGACTGAGGTTCAAA GACCCACACACGCACAAGACCAGATGCTGCGTCATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_008975 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_008975.3 |
RefSeq Size | 3608 bp |
RefSeq ORF | 522 bp |
Locus ID | 19245 |
UniProt ID | Q9D658 |
MW | 19.7 kDa |
Gene Summary | Protein tyrosine phosphatase which stimulates progression from G1 into S phase during mitosis. Enhances cell proliferation, cell motility and invasive activity, and promotes cancer metastasis. May be involved in the progression of cardiac hypertrophy by inhibiting intracellular calcium mobilization in response to angiotensin II.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has an alternate 5' UTR exon, as compared to variant 1. Variants 1, 2, 3 and 5 encode the same isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC205828 | Ptp4a3 (untagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2, (10ug) |
CNY 2400.00 |
|
MG201490 | Ptp4a3 (tGFP-tagged) - Mouse protein tyrosine phosphatase 4a3 (pPtp4a3) |
CNY 2850.00 |
|
MG225303 | Ptp4a3 (tGFP-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3) transcript variant 2, (10ug) |
CNY 2850.00 |
|
MR225303 | Ptp4a3 (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2 |
CNY 2400.00 |
|
MR225303L3 | Lenti ORF clone of Ptp4a3 (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2 |
CNY 4750.00 |
|
MR225303L4 | Lenti ORF clone of Ptp4a3 (mGFP-tagged) - Mouse protein tyrosine phosphatase 4a3 (Ptp4a3), transcript variant 2 |
CNY 4750.00 |