5330431N19Rik (BC027559) Mouse Untagged Clone

CAT#: MC206984

5330431N19Rik (untagged) - Mouse RIKEN cDNA 5330431N19 gene (cDNA clone MGC:41405 IMAGE:1493971), (10ug)



  "BC027559" in other vectors (4)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5330431N19Rik; Ndac
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206984 representing BC027559.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGTGACTAGCTGGTTGGAGGTTTTGCGGTCGGCCGAGAAGACGGCACTGCTGCAGGATGGGAAG
AGGATGGTGCACTATTTGTTCCCAGACGGGAAGGAAATGGCAGAAGAATATGACGAGAAGACCAGTGAA
CTCCTTGTGAGGAAGTGGCGTGTGAAAAATGCCCTGGGAGCCTTGGGCCAGTGGCAGCTTGAAGTGGGA
GAGCCAGTGCCCTCAGGAGCTGGGAGCCTGGGATCCGAGCTCATCAAAGAAACCCATCTTCATGCGCAA
GGACACCAAAACAAGTTTCCAGTGGCGGATTCGAAATCTCCCCTACCCGAAGGATGTGTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC027559
Insert Size 339 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC027559
RefSeq Size 850 bp
RefSeq ORF 338 bp
Locus ID 226162
MW 12.4 kDa
Gene Summary May play a role in the formation or function of ciliated cells.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...