AI842396 (BC096427) Mouse Untagged Clone

CAT#: MC206968

AI842396 (untagged) - Mouse expressed sequence AI842396 (cDNA clone MGC:106026 IMAGE:4160694), (10ug)



  "BC096427" in other vectors (4)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
INCA1 Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Inca1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206968 representing BC096427.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTCAGCCGTATGGAGATGCCTTCTGGGAGAATCTTAGCCAAAGGTCTAGCTCCAATTGGATGGTA
GAACAGTACATTCCACCAATTCTGAGGGCCACTGATTGCTCCCGGCCTAGCCTGCACCCTCTTGAGGGG
CTCCCTCCTCCTGAGAAGCTTTGGAGAAGAAAGAGAAAGAAGCTGCATTTGGAAAGAATGCAGAAGGGA
CCTGGAAGCATTCCAGCCCGAGTTAGAGCAGTTACTTATCATCTGGAGGACCTGAGAAGGCGCCAGGGA
ATCATCAATGAACTGAAGAGGGCCCAGTGGGGCAGCTCTGATGCTACACCTGAACTTCCAGCACTTGAA
GAGGGCTTTGAACTCCTAAGCACTACAAAATACTTTGACGTGGAAGAAGAGAGGGCAACCTATCCACAG
AAAGAGACTTATTCTGTCACTCCCAGAGATCAGCTGCTTTGGACTCCCTGGACTCCTGTAGGCCAGCAG
GGGACTTATGCCTCTGGGCAGCTAAGCTCTTTGACCTACAGCACTGCTACAGCCAGAAAGAACCCCGTT
TACGATCCCCAGGCGATGGAGTTGGAGTCTGAGGAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC096427
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC096427
RefSeq Size 1299 bp
RefSeq ORF 590 bp
Locus ID 103844
MW 22.6 kDa
Gene Summary Binds to CDK2-bound cyclins and inhibits the kinase activity of CDK2; binding to cyclins is critical for its function as CDK inhibitor. Inhibits cell growth and proliferation and may play a role in cell cycle control (PubMed:21540187). Required for ING5-mediated regulation of S-phase progression, enhancement of Fas-induced apoptosis and inhibition of cell growth (PubMed:21750715).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...