Rap2c (BC027363) Mouse Untagged Clone
CAT#: MC206944
Rap2c (untagged) - Mouse RAP2C, member of RAS oncogene family (cDNA clone MGC:36337 IMAGE:4951566), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2010200P20Rik; AI194294; AL022976 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206944 representing BC027363.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGGAATACAAGGTAGTGGTGTTAGGGAGCGGAGGGGTTGGCAAATCTGCCCTCACCGTGCAGTTT GTCACCGGGACTTTCATTGAGAAATATGACCCCACCATTGAAGATTTCTACCGCAAAGAGATCGAAGTG GACTCTTCCCCGTCAGTACTGGAAATCCTGGACACCGCAGGAACCGAGCAGTTTGCCTCCATGAGAGAT CTGTACATCAAGAACGGCCAAGGTTTCATCCTGGTGTATAATTTGGTTAATCAACAGTCTTTTCAGGAT ATCAAGCCAATGAGAGATCAGATTGTGAGAGTGAAGAGATACGAGAAAGTCCCACTCATCCTAGTGGGA AACAAAGTGGATCTGGAACCAGAGAGAGAGGTTATGTCTTCCGAAGGCAGAGCTCTGGCTCAAGAATGG GGCTGTCCTTTCATGGAAACGTCAGCAAAAAGTAAATCAATGGTGGATGAACTTTTTGCTGAGATCGTC AGGCAAATGAACTATTCATCCCTGCCCGAGAAGCAAGATCAGTGTTGTACAACTTGTGTTGTCCAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC027363 |
| Insert Size | 552 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027363 |
| RefSeq Size | 2338 bp |
| RefSeq ORF | 551 bp |
| Locus ID | 72065 |
| MW | 20.8 kDa |
| Gene Summary | Small GTP-binding protein which cycles between a GDP-bound inactive and a GTP-bound active form. May play a role in cytoskeletal rearrangements and regulate cell spreading through activation of the effector TNIK. May play a role in SRE-mediated gene transcription.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201656 | Rap2c (tGFP-tagged) - Mouse RAP2C, member of RAS oncogene family (cDNA clone MGC:36337 IMAGE:4951566) |
CNY 2850.00 |
|
| MR201656 | Rap2c (Myc-DDK-tagged) - Mouse RAP2C, member of RAS oncogene family (cDNA clone MGC:36337 IMAGE:4951566) |
CNY 2400.00 |
|
| MR201656L3 | Lenti ORF clone of Rap2c (Myc-DDK-tagged) - Mouse RAP2C, member of RAS oncogene family (cDNA clone MGC:36337 IMAGE:4951566) |
CNY 4750.00 |
|
| MR201656L4 | Lenti ORF clone of Rap2c (mGFP-tagged) - Mouse RAP2C, member of RAS oncogene family (cDNA clone MGC:36337 IMAGE:4951566) |
CNY 4750.00 |
