Nola1 (BC021873) Mouse Untagged Clone
CAT#: MC206920
Nola1 (untagged) - Mouse nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs) (cDNA clone MGC:28064 IMAGE:3709271),, (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | GAR1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206920 representing BC021873.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTTTCCGAGGCGGAGGTCGCGGAGGCTTTAATCGCGGTGGTGGAGGCGGAGGCTTCAACCGCGGA GGCGGCGGCGGCAGTTTCAGGGGCGGAGGCGGCGGCGGCAGTTTCAGGGGCGGCGGCCGAGGAGGATTT GGACGAGGGGGCGGTCGTGGAGGCTTTAATAAATTTCAAGATCAAGGGCCTCCAGAACGTGTCGTCTTG TTAGGAGAATTCATGCATCCCTGTGAAGATGACATCGTGTGTAAATGTACCACCGAGGAGAACAAGGTG CCCTACTTCAACGCCCCTGTTTACTTAGAAAACAAAGAGCAAGTCGGGAAAGTGGATGAGATATTTGGA CAGCTTAGAGATTTTTATTTTTCAGTTAAGTTGTCAGAAAACATGAAGGCATCTTCCTTTAAAAAGCTA CAGAAGTTCTATATAGACCCATACAAGCTGCTGCCGCTGCAGAGGTTTCTGCCTCGTCCTCCTGGTGAG AAAGGACCTCCCAGAGGTGGCGGCGGTGGCGGCAGGGGAGGTCGAGGAGGAGGAAGAGGAGGCGGTGGC CGAGGTGGTGGAAGAGGTGGTGGTTTTAGAGGAGGCAGAGGAGGAGGTGGGGGCTTCAGAGGAGGCCGA GGAGGCGGCGGATTCCGAGGAAGGGGACATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC021873 |
| Insert Size | 654 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC021873 |
| RefSeq Size | 1145 bp |
| RefSeq ORF | 653 bp |
| Locus ID | 68147 |
| MW | 22.3 kDa |
| Gene Summary | Required for ribosome biogenesis and telomere maintenance. Part of the H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA. This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1. Each rRNA can contain up to 100 pseudouridine ("psi") residues, which may serve to stabilize the conformation of rRNAs. May also be required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202402 | Nola1 (tGFP-tagged) - Mouse nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs) (cDNA clone MGC:28064 IMAGE:3709271) |
CNY 2850.00 |
|
| MR202402 | Nola1 (Myc-DDK-tagged) - Mouse nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs) (cDNA clone MGC:28064 IMAGE:3709271) |
CNY 2400.00 |
|
| MR202402L3 | Lenti ORF clone of Nola1 (Myc-DDK-tagged) - Mouse nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs) (cDNA clone MGC:28064 IMAGE:3709271) |
CNY 4750.00 |
|
| MR202402L4 | Lenti ORF clone of Nola1 (mGFP-tagged) - Mouse nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs) (cDNA clone MGC:28064 IMAGE:3709271) |
CNY 4750.00 |
