Rnf41 (BC019415) Mouse Untagged Clone
CAT#: MC206913
Rnf41 (untagged) - Mouse ring finger protein 41 (cDNA clone MGC:30902 IMAGE:4014525), (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 4933415P08Rik, FLRF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206913 representing BC019415.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCAAAGATGAACTGCCAAACCACAATTGCATTAAGCACCTGCGCTCCGTGGTCCAGCAGCAGCAG TCGCGCATCGCAGAGCTGGAGAAGACCAGGGCTGAACACAAGCACCAGCTGGCAGAGCAGAAGCGAGAC ATTCAGCTGCTGAAGGCGTATATGCGAGCCATCCGCAGTGTCAACCCCAACCTTCAGAACCTGGAGGAG ACAATCGAATACAACGAGATCCTCGAGTGGGTGAACTCCCTGCAGCCGGCAAGGGTGACCCGCTGGGGG GGCATGATCTCCACTCCTGATGCTGTGCTCCAGGCTGTCATCAAGCGCTCCCTCGTGGAAAGTGGCTGC CCGGCCTCCATCGTCAACGAGCTGATTGAAAATGCCCATGAACGCAGTTGGCCCCAGGGTCTGGCCACA CTAGAGACAAGACAGATGAACCGGCGCTACTATGAGAACTACGTGGCCAAGCGCATCCCTGGCAAGCAG GCTGTAGTGGTGATGGCCTGTGAGAACCAGCACATGGGGGACGACATGGTGCAGGAGCCAGGGCTCGTC ATGATATTTGCGCATGGTGTGGAGGAGATATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC019415 |
Insert Size | 585 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC019415 |
RefSeq Size | 1739 bp |
RefSeq ORF | 584 bp |
Locus ID | 67588 |
MW | 22.3 kDa |
Gene Summary | Acts as E3 ubiquitin-protein ligase and regulates the degradation of target proteins. Polyubiquitinates MYD88 (By similarity). Negatively regulates MYD88-dependent production of proinflammatory cytokines. Can promote TRIF-dependent production of type I interferon and inhibits infection with vesicular stomatitis virus. Promotes also activation of TBK1 and IRF3 (PubMed:19483718). Involved in the ubiquitination of erythropoietin (EPO) and interleukin-3 (IL-3) receptors. Thus, through maintaining basal levels of cytokine receptors, RNF41 is involved in the control of hematopoietic progenitor cell differentiation into myeloerythroid lineages (PubMed:18495327). Contributes to the maintenance of steady-state ERBB3 levels by mediating its growth factor-independent degradation. Involved in the degradation of the inhibitor of apoptosis BIRC6 and thus is an important regulator of cell death by promoting apoptosis. Acts also as a PRKN modifier that accelerates its degradation, resulting in a reduction of PRKN activity, influencing the balance of intracellular redox state. The RNF41-PRKN pathway regulates autophagosome-lysosome fusion during late mitophagy. Mitophagy is a selective form of autophagy necessary for mitochondrial quality control (PubMed:24949970).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201892 | Rnf41 (tGFP-tagged) - Mouse ring finger protein 41 (cDNA clone MGC:30902 IMAGE:4014525) |
CNY 2850.00 |
|
MR201892 | Rnf41 (Myc-DDK-tagged) - Mouse ring finger protein 41 (cDNA clone MGC:30902 IMAGE:4014525) |
CNY 2400.00 |
|
MR201892L3 | Lenti ORF clone of Rnf41 (Myc-DDK-tagged) - Mouse ring finger protein 41 (cDNA clone MGC:30902 IMAGE:4014525) |
CNY 4750.00 |
|
MR201892L4 | Lenti ORF clone of Rnf41 (mGFP-tagged) - Mouse ring finger protein 41 (cDNA clone MGC:30902 IMAGE:4014525) |
CNY 4750.00 |