Polr3g (BC030063) Mouse Untagged Clone
CAT＃: MC206910
Polr3g (untagged) - Mouse polymerase (RNA) III (DNA directed) polypeptide G (cDNA clone MGC:41022 IMAGE:1446833), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | RPC7, RPC32 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206910 representing BC030063.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGGCAATAAAGGAAGAGGGCGTGCTGCCTACACCTTTAATATCGAAGCTGTTGGATTCAGCAGA GGGGAGAAGTTACCTGATGTTGTGTTGAAGCCTCCACCCCTGTTTCCTGATACAGACTACAAGCCGGTG CCCCTGAAAACGGGAGAAGATGAGGATTACATGCTGGCCTTGAAGCAGGAGTTGAGGGAAACAGTGAAA CGATTGCCGTACTTTATTGAACCACCCGAAGAAAAACAAGGTACGCATGCGCGTCAGGCCCTTCCGGAG GCTGGCAGTTCAGTGTTCACAGAAGGAGCAGTGGATGCGGGGACCTGTGATCATGTGACTCAGCCGATC ACCCAACTTGAAAAAACATTACTTACCAGAATTGTCAGAAAGGAAAAACATTTATATTTTATTGTATTG TTTTTCTTCTTTTTTTTTTTGCAACTTACTCATAATACTTTGTGTCTTCCTTTTGTAATACAATATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC030063 |
| Insert Size | 483 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC030063 |
| RefSeq Size | 753 bp |
| RefSeq ORF | 482 bp |
| Locus ID | 67486 |
| MW | 18.2 kDa |
| Gene Summary | DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific peripheric component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. May direct with other members of the RPC3/POLR3C-RPC6/POLR3F-RPC7/POLR3G subcomplex RNA Pol III binding to the TFIIIB-DNA complex via the interactions between TFIIIB and POLR3F. May be involved either in the recruitment and stabilization of the subcomplex within RNA polymerase III, or in stimulating catalytic functions of other subunits during initiation. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts induce type I interferon and NF- Kappa-B through the RIG-I pathway.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201232 | Polr3g (tGFP-tagged) - Mouse polymerase (RNA) III (DNA directed) polypeptide G (cDNA clone MGC:41022 IMAGE:1446833) |
CNY 2850.00 |
|
| MR201232 | Polr3g (Myc-DDK-tagged) - Mouse polymerase (RNA) III (DNA directed) polypeptide G (cDNA clone MGC:41022 IMAGE:1446833) |
CNY 1200.00 |
|
| MR201232L3 | Lenti ORF clone of Polr3g (Myc-DDK-tagged) - Mouse polymerase (RNA) III (DNA directed) polypeptide G (cDNA clone MGC:41022 IMAGE:1446833) |
CNY 4750.00 |
|
| MR201232L4 | Lenti ORF clone of Polr3g (mGFP-tagged) - Mouse polymerase (RNA) III (DNA directed) polypeptide G (cDNA clone MGC:41022 IMAGE:1446833) |
CNY 4750.00 |
