Ing5 (BC064674) Mouse Untagged Clone

CAT#: MC206898

Ing5 (untagged) - Mouse inhibitor of growth family, member 5 (cDNA clone MGC:66742 IMAGE:6400183), (10ug)



  "BC064674" in other vectors (4)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700001C14Rik; 1700027H23Rik; 1810018M11Rik; AI225768
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206898 representing BC064674.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGACCTACGAGATGGTGGATAAACACATCCGAAGACTTGATGCTGACCTGGCGCGCTTTGAGGCT
GACCTGAAGGACAGGATGGATGGAAGTGACTTTGAGAGCACTGGAGCACGGAGCTTGAAAAAAGGCCGG
AGTCAGAAAGAAAAAAGAAGCTCCCGGGGCCGAGGCCGGCGGACGTCAGAAGAGGATACCCCAAAGAAG
AAGAAACATAAAAGCGGGTCTGAGTTTACTGACAGTATCCTATCTGTGCACCCCTCTGATGTGCTGGAC
ATGCCTGTGGATCCGAATGAGCCTACATACTGCTTGTGCCACCAGGTGTCCTACGGGGAGATGATCGGC
TGTGACAATCCAGATTGTCCCATTGAGTGGTTTCACTTTGCCTGCGTGGATCTCACCACAAAGCCCAAA
GGAAAGTGGTTTTGTCCACGATGTGTTCAGGAAAAGAGGAAGAAGAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC064674
Insert Size 465 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC064674
RefSeq Size 4579 bp
RefSeq ORF 464 bp
Locus ID 66262
MW 17.8 kDa
Gene Summary Component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Component of the MOZ/MORF complex which has a histone H3 acetyltransferase activity. May function as a transcriptional coactivator for RUNX2. Inhibits cell growth, induces a delay in S-phase progression and enhances Fas-induced apoptosis in an INCA1-dependent manner (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...