Phca (BC023924) Mouse Untagged Clone
CAT#: MC206896
Phca (untagged) - Mouse phytoceramidase, alkaline (cDNA clone MGC:36600 IMAGE:5324078), (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110057L18Rik; 5430429L08Rik; AV015045; Phca |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206896 representing BC023924.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTCCGGCTGTGGACCGCAAAGGCTATTGGGGCCCCACGACCTCCACATTGGACTGGTGTGAGGAG AACTATGTGGTGACCTTGTTCGTCGCTGAGTTCTGGAATACAGTGAGTAACCTGATTATGATCATACCT CCAATTTTTGGTGCAATTCAAGGCATTAGAGACAGACTGGAGAAGCGGTACATTGCTGCTTACTTAGCA CTCACAGTGGTAGGAATGGGATCCTGGTGTTTCCACATGACTCTGAAATATGAAATGCAGCTGTTGGAT GAGCTCCCCATGATTTACAGCTGCTGCATATTTGTATACTGCATGTTTGAGTGTTTCAAGACAAAGAGC TCAATAAACTACCATCTTCTTTTTACCCTATTTCTATACAGTTTAACAGTAACTACGATTTACCTAAAA GTCAAAGAACCTATATTCCATCAGGTCATGTATGGAATGTTGGTCTTTACATTAGTACTTCGTTCTATT TATATTGTTACATGTGTATCTCCAGAGTCTTGTCTGTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC023924 |
Insert Size | 525 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC023924 |
RefSeq Size | 1460 bp |
RefSeq ORF | 524 bp |
Locus ID | 66190 |
MW | 20.3 kDa |
Gene Summary | Endoplasmic reticulum and Golgi ceramidase that catalyzes the hydrolysis of unsaturated long-chain C18:1-, C20:1- and C20:4-ceramides, dihydroceramides and phytoceramides into sphingoid bases like sphingosine and free fatty acids at alkaline pH (PubMed:26474409). Ceramides, sphingosine, and its phosphorylated form sphingosine-1-phosphate are bioactive lipids that mediate cellular signaling pathways regulating several biological processes including cell proliferation, apoptosis and differentiation (PubMed:26474409). Controls the generation of sphingosine in erythrocytes, and thereby sphingosine-1-phosphate in plasma (By similarity). Through the regulation of ceramides and sphingosine-1-phosphate homeostasis in the brain may play a role in neurons survival and function (PubMed:26474409). By regulating the levels of proinflammatory ceramides in immune cells and tissues, may modulate the inflammatory response (PubMed:26938296).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201511 | Phca (tGFP-tagged) - Mouse phytoceramidase, alkaline (cDNA clone MGC:36600 IMAGE:5324078) |
CNY 2850.00 |
|
MR201511 | Phca (Myc-DDK-tagged) - Mouse phytoceramidase, alkaline (cDNA clone MGC:36600 IMAGE:5324078) |
CNY 2400.00 |
|
MR201511L3 | Lenti ORF clone of Phca (Myc-DDK-tagged) - Mouse phytoceramidase, alkaline (cDNA clone MGC:36600 IMAGE:5324078) |
CNY 4750.00 |
|
MR201511L4 | Lenti ORF clone of Phca (mGFP-tagged) - Mouse phytoceramidase, alkaline (cDNA clone MGC:36600 IMAGE:5324078) |
CNY 4750.00 |