Pla2g10 (BC028879) Mouse Untagged Clone
CAT#: MC206866
Pla2g10 (untagged) - Mouse phospholipase A2, group X (cDNA clone MGC:25894 IMAGE:4218273), (10ug)
CNY 3230.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | PLA2GX, mGXsPLA2, sPLA2-X |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC206866 representing BC028879.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGCTGCTACTGCTGCTGTTGCTGCTGGGACCTGGACCCGGATTCAGCGAAGCAACCAGGAGGTCA CATGTATACAAGCGTGGACTCCTGGAGCTGGCAGGGACCTTGGATTGTGTTGGGCCTCGATCTCCGATG GCTTACATGAACTATGGCTGTTATTGTGGCCTTGGTGGCCATGGAGAGCCACGTGACGCCATTGACTGG TGCTGCTACCACCACGACTGCTGCTACTCTCGGGCTCAGGACGCTGGCTGCAGCCCTAAGTTAGACCGC TACCCATGGAAGTGCATGGACCATCACATCCTGTGTGGTGAGTGCCCTATGCCGTGTGACTTCCCCAAG TGCCCACTGGACATCCTGCAGATCCCAATGGCTCCTGTACCCTTGTGGACCAGCAGAGAACAAATGCCA AGAACTTTTGTGCAGGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | BC028879 |
| Insert Size | 435 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC028879 |
| RefSeq Size | 1011 bp |
| RefSeq ORF | 434 bp |
| Locus ID | 26565 |
| MW | 16.2 kDa |
| Gene Summary | This gene encodes a member of the phospholipase A2 family of lipolytic enzymes that hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids. The encoded protein undergoes proteolytic processing to generate a calcium-dependent enzyme that plays pivotal roles in the liberation of arachidonic acid from membrane phospholipids leading to the production of various inflammatory lipid mediators, such as prostaglandins. In response to myocardial ischemia/reperfusion, mice lacking the encoded protein display a reduction in myocardial infarct size partly through the suppression of neutorphil cytotoxic activities. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200952 | Pla2g10 (tGFP-tagged) - Mouse phospholipase A2, group X (cDNA clone MGC:25894 IMAGE:4218273) |
CNY 2090.00 |
|
| MR200952 | Pla2g10 (Myc-DDK-tagged) - Mouse phospholipase A2, group X (cDNA clone MGC:25894 IMAGE:4218273) |
CNY 1200.00 |
|
| MR200952L3 | Lenti ORF clone of Pla2g10 (Myc-DDK-tagged) - Mouse phospholipase A2, group X (cDNA clone MGC:25894 IMAGE:4218273) |
CNY 3800.00 |
|
| MR200952L4 | Lenti ORF clone of Pla2g10 (mGFP-tagged) - Mouse phospholipase A2, group X (cDNA clone MGC:25894 IMAGE:4218273) |
CNY 3800.00 |
其它Pla2g10产品
