Clec4d (NM_001163161) Mouse Untagged Clone

CAT#: MC206842

Clec4d (untagged) - Mouse C-type lectin domain family 4, member d (Clec4d), transcript variant 2, (10ug)



  "NM_001163161" in other vectors (3)

CNY 3230.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Clecsf8; mcl; Mpcl
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206842 representing NM_001163161.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGCTGGAAGAATCCCAAATGAAATCAAAAGGTACCCGACATCCCCAACTGATCCCTTGCGTCTTC
GCTGTTGTTTCCATCTCGTTCCTTAGTGCTTGCTTTATTTCAACTTGTTTGGTGACTCATCATTACTTT
TTACGCTGGACGAGAGGAAGTGTGGTGAAACTGTCAGACTACCACACGAGAGTAACGTGCATCCGAGAG
GAGCCACAGCCTGGAGCTACAGGTACTTGGACCTGCTGTCCTGTTAGCTGGAGAGCCTTCCAGTCTAAC
TGTTACTTTCCTCTTAATGACAACCAGACCTGGCATGAGAGCGAGAGGAACTGCTCAGGGATGAGCAGT
CATCTGGTGACCATCAACACCGAAGCAGAACAGAATTTTGTGACCCAGCTTTTGGATAAACGGTTTTCT
TATTTCCTGGGACTTGCTGATGAGAATGTGGAAGGCCAATGGCAGTGGGTGGACAAGACGCCATTTAAC
CCACACACGGTATTCTGGGAAAAGGGGGAATCCAATGACTTTATGGAAGAAGACTGTGTTGTCCTTGTT
CATGTCCATGAAAAATGGGTCTGGAATGACTTTCCTTGTCACTTTGAGGTGAGAAGGATTTGTAAATTA
CCTGGAATAACATTCAATTGGAAGCCCTCGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001163161
Insert Size 657 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001163161.1
RefSeq Size 1333 bp
RefSeq ORF 657 bp
Locus ID 17474
UniProt ID Q9Z2H6
MW 25.6 kDa
Gene Summary A calcium-dependent lectin involved in innate recognition of pathogen-associated molecular patterns (PAMPs). Interacts with signaling adapter Fc receptor gamma chain/FCER1G, likely via CLEC4E, to form a functional complex in antigen presenting cells. Binding of mycobacterial trehalose 6,6'-dimycolate (TDM) to this receptor complex leads to phosphorylation of the immunoreceptor tyrosine-based activation motif (ITAM) of FCER1G, triggering activation of SYK, CARD9 and NF-kappa-B, consequently driving maturation of antigen-presenting cells and shaping antigen-specific priming of T-cells toward effector T-helper 1 and T-helper 17 cell subtypes (PubMed:23602766). Functions as an endocytic receptor. May be involved in antigen uptake at the site of infection, either for clearance of the antigen, or for processing and further presentation to T-cells (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. This results in a shorter isoform (2) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...