Mcpt4 (BC026198) Mouse Untagged Clone
CAT#: MC206841
Mcpt4 (untagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753), (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MMCP-4, MMCP-4A, MMCP-4B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206841 representing BC026198.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGGCCCTACTATTCCTTATGGCACTTCTCTTGCCTTCTGGGGCTGGAGCTGAGGAGATTATTGGT GGTGTTGAGTCTAGACCACATTCTCGCCCTTACATGGCCCATCTGGAGATCACCACTGAGAGAGGGTTC ACAGCTACCTGTGGTGGGTTTCTCATAACCCGCCAATTTGTGTTGACTGCTGCACACTGTAGTGGAAGA GAAATCACTGTCACCCTTGGAGCTCATGATGTGAGCAAGACAGAATCCACACAGCAGAAGATAAAAGTA GAAAAACAAATCGTTCACCCAAAGTACAACTTCTATTCCAATCTCCATGACATCATGTTGCTGAAGCTT CAAAAGAAAGCCAAAGAGACTCCCTCTGTGAATGTAATTCCTCTGCCTCGTCCTTCTGACTTTATCAAG CCGGGGAAGATGTGCCAGCCTGCCCCCAAGATGATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC026198 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC026198 |
RefSeq Size | 554 bp |
RefSeq ORF | 452 bp |
Locus ID | 17227 |
MW | 16.6 kDa |
Gene Summary | Has chymotrypsin-like activity. Hydrolyzes the amide bonds of synthetic substrates having Tyr and Phe residues at the P1 position. Preferentially hydrolyzes the 'Tyr-4-|-Ile-5' bond of angiotensin I and the 'Phe-20-|-Ala-21' bond of amyloid beta-protein, and is less active towards the 'Phe-8-|-His-9' bond of angiotensin I and the 'Phe-4-|-Ala-5' and 'Tyr-10-|-Glu-11' bonds of amyloid beta-protein. Involved in thrombin regulation and fibronectin processing.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201056 | Mcpt4 (tGFP-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) |
CNY 2850.00 |
|
MR201056 | Mcpt4 (Myc-DDK-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) |
CNY 1200.00 |
|
MR201056L3 | Lenti ORF clone of Mcpt4 (Myc-DDK-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) |
CNY 4750.00 |
|
MR201056L4 | Lenti ORF clone of Mcpt4 (mGFP-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) |
CNY 4750.00 |