Cck (BC028487) Mouse Untagged Clone
CAT#: MC206823
Cck (untagged) - Mouse cholecystokinin (cDNA clone MGC:41001 IMAGE:1400830), (10ug)
CNY 3230.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206823 representing BC028487.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGAGCGGCGTATGTCTGTGCGTGGTGATGGCAGTCCTAGCTGCTGGCGCCCTGGCGCAGCCGGTA GTCCCTGCAGAAGCTACGGACCCCGTGGAGCAGCGGGCGCAAGAGGCGCCCCGAAGGCAGCTGCGGGCT GTGCTCCGGACGGACGGCGAGCCCCGAGCGCGCCTGGGCGCACTGCTAGCGCGATACATCCAGCAGGTC CGCAAAGTGGCATGGATGGTGACCTCTGGTTGGGTGTTAACCTGGACCAGTAGAGCTGGATTAAAACAC AGGAGGTGGGCATCCTTTCTGTGGAGCTCACGAACCCAATTTTTCCTGCCCGCATTTGAACAGCCCATG GCTTGTCGACCTGTCTGCATTTGGCTTGACTGCTCCTTCTGGCCGCATGTCCGTTCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC028487 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC028487 |
RefSeq Size | 816 bp |
RefSeq ORF | 404 bp |
Locus ID | 12424 |
MW | 15.2 kDa |
Gene Summary | This gene encodes a member of the gastrin/cholecystokinin family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the peptide hormones cholecystokinin-8, -12, -33, and others. The encoded peptides have been shown to regulate gastric acid secretion and food intake. A sulfated form of cholecystokinin-8 may modulate neuronal activity in the brain. Homozygous knockout mice for this gene exhibit impaired insulin secretion, enhanced insulin sensitivity, and resistance to obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200794 | Cck (tGFP-tagged) - Mouse cholecystokinin (cDNA clone MGC:41001 IMAGE:1400830) |
CNY 2850.00 |
|
MR200794 | Cck (Myc-DDK-tagged) - Mouse cholecystokinin (cDNA clone MGC:41001 IMAGE:1400830) |
CNY 1200.00 |
|
MR200794L3 | Lenti ORF clone of Cck (Myc-DDK-tagged) - Mouse cholecystokinin (cDNA clone MGC:41001 IMAGE:1400830) |
CNY 3600.00 |
|
MR200794L4 | Lenti ORF clone of Cck (mGFP-tagged) - Mouse cholecystokinin (cDNA clone MGC:41001 IMAGE:1400830) |
CNY 3600.00 |