C1qb (BC067001) Mouse Untagged Clone

CAT#: MC206108

C1qb (untagged) - Mouse complement component 1, q subcomponent, beta polypeptide (cDNA clone MGC:90036 IMAGE:5715633), complete, (10ug)



CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
C1QB Antibody - middle region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC067001
GGCTCTGGGCTCTGGGAATCCACTGCTGTCCGGCCTAGAAGCATCACAGAACACCAGGATTCCATACACA GGAAGCCCCTGAGGCTGAGCTGATGAAGACACAGTGGGGTGAGGTCTGGACACACCTGTTACTGCTGCTT CTAGGTTTTCTCCATGTGTCCTGGGCCCAAAGCAGCTGCACCGGGCCCCCTGGCATCCCTGGCATCCCTG GGGTCCCTGGGGTTCCTGGCTCTGATGGCCAACCAGGCACTCCAGGGATAAAGGGGGAGAAAGGGCTCCC TGGACTGGCTGGAGACCTTGGTGAGTTTGGAGAGAAAGGGGACCCAGGGATCCCTGGGACTCCAGGCAAA GTTGGCCCTAAGGGTCCCGTCGGCCCTAAGGGTACTCCAGGCCCCTCTGGACCCCGCGGTCCCAAAGGCG ATTCTGGGGACTACGGGGCTACACAGAAAGTCGCCTTCTCTGCCCTGAGGACCATCAACAGCCCCTTGCG ACCGAACCAGGTCATTCGCTTCGAAAAGGTGATCACCAACGCGAACGAGAACTATGAGCCACGCAACGGC AAGTTCACCTGCAAGGTGCCTGGCCTCTACTACTTCACCTATCATGCCAGCTCCCGGGGCAACCTGTGTG TGAATCTCGTTCGTGGCCGCGATCGGGACAGCATGCAGAAAGTAGTCACCTTCTGTGACTATGCCCAGAA CACCTTCCAGGTGACCACAGGTGGGGTAGTCTTGAAGCTAGAGCAAGAGGAGGTTGTTCACCTGCAGGCC ACAGACAAGAACTCCCTCCTGGGCATTGAGGGTGCCAACAGCATCTTCACTGGCTTTCTGCTTTTCCCTG ACATGGATGCGTAATCACGGGGTCAAATTACACCTATCCAACACCATCTTCCTGCCTCCCTGCCAGCAAT CCTCCCTGGACCCCTGACATCACCCCCTTGACTGCCTGAAACCCAGACCAGAGCCCTGTAGATGTTACAG AACGAATGGGTCAATAAACTCTTCAAGGCCAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
ACCN BC067001
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC067001, AAH67001
RefSeq Size 1027 bp
RefSeq ORF 762 bp
Locus ID 12260
Gene Summary C1q associates with the proenzymes C1r and C1s to yield C1, the first component of the serum complement system. The collagen-like regions of C1q interact with the Ca(2+)-dependent C1r(2)C1s(2) proenzyme complex, and efficient activation of C1 takes place on interaction of the globular heads of C1q with the Fc regions of IgG or IgM antibody present in immune complexes.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...