Hint1 (BC070415) Mouse Untagged Clone

CAT#: MC206106

Hint1 (untagged) - Mouse histidine triad nucleotide binding protein 1 (cDNA clone MGC:99939 IMAGE:5714321), (10ug)



CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms PKCI-1, PRKCNH1, Ipk1, Hint
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC070415
CGCAGGCCCACCGGGCGCGAGCCGGCAGTCTCCGCGCGCTCCCGCGGTTCCTCTCCCCACTGTGGCCGCG GCGCGGGAAGGACAGTGAGCGGCCGCGATGGCTGACGAGATTGCCAAGGCTCAAGTGGCCCAGCCCGGCG GCGACACGATCTTCGGCAAGATCATCCGCAAAGAAATCCCCGCCAAGATCATCTTCGAGGACGACCGGTG TCTTGCTTTTCATGACATTTCCCCTCAAGCACCAACACACTTTCTGGTGATACCCAAGAAGCATATATCC CAGATTTCTGTAGCAGATGATGATGATGAAAGTCTTCTAGGACATTTAATGATTGTTGGCAAGAAATGTG CTGCAGATCTGGGCCTGAAGCGCGGGTACCGGATGGTGGTGAATGAAGGTGCAGACGGGGGACAGTCTGT CTATCACATTCACCTCCATGTCCTTGGGGGTCGGCAGATGAACTGGCCTCCTGGTTAAAGCAGGTTGGGG ATAAAGTGTCCTTCTCTAGATAGTTGGCAAGCTCCAGTAAGATAAATGGCACACGTAGTTTTGCCTGTAT ATGGAGAAATTGAAGAGATCATTTAAAATTCTGTGCCTAATAAAAGACATTGTTGCAAAAAAAAAAAAAA AAAA
Restriction Sites AscI-NotI     
ACCN BC070415
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC070415, AAH70415
RefSeq Size 634 bp
RefSeq ORF 381 bp
Locus ID 15254
Gene Summary Hydrolyzes purine nucleotide phosphoramidates with a single phosphate group, including adenosine 5'monophosphoramidate (AMP-NH2), adenosine 5'monophosphomorpholidate (AMP-morpholidate) and guanosine 5'monophosphomorpholidate (GMP-morpholidate). Hydrolyzes lysyl-AMP (AMP-N-epsilon-(N-alpha-acetyl lysine methyl ester)) generated by lysine tRNA ligase, as well as Met-AMP, His-AMP and Asp-AMP, lysyl-GMP (GMP-N-epsilon-(N-alpha-acetyl lysine methyl ester)) and AMP-N-alanine methyl ester. Can also convert adenosine 5'-O-phosphorothioate and guanosine 5'-O-phosphorothioate to the corresponding nucleoside 5'-O-phosphates with concomitant release of hydrogen sulfide. In addition, functions as scaffolding protein that modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex and by the complex formed with MITF and CTNNB1. Modulates p53/TP53 levels and p53/TP53-mediated apoptosis. Modulates proteasomal degradation of target proteins by the SCF (SKP2-CUL1-F-box protein) E3 ubiquitin-protein ligase complex (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...