Rit1 (NM_009069) Mouse Untagged Clone
CAT#: MC205693
Rit1 (untagged) - Mouse Ras-like without CAAX 1 (Rit1), transcript variant 1, (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | RIBB; Rit; ROC1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012694
CCACGCGTCCGGCAGCTGGGAAAGGAACGCGGGTTACCACCCGGCCTCAAAGCTGGTTTCAGAGGAGGCC TTTCCCAGGGGCCCAGGACTGCCCCGGAGGACAATGGAGTCCGGAGCTCGCCCCATTGGTAGCAGCTGTA GCAGCCCTGCAGCACTCTCCCGGGAATACAAACTAGTGATGCTGGGTGCCGGTGGAGTTGGGAAGAGTGC CATGACAATGCAGTTCATCAGCCACCGATTCCCAGAAGACCATGACCCCACCATTGAAGATGCTTATAAG ATCCGGATCCGCATTGATGATGAACCTGCCAATCTGGACATCCTGGACACAGCAGGACAGGCAGAGTTTA CAGCCATGCGGGATCAGTATATGAGGGCAGGAGAAGGATTCATCATCTGTTACTCCATCACGGATCGTCG AAGTTTCCACGAAGTTCGGGAGTTTAAACAACTGATTTACCGGGTCCGACGCACCGATGATACACCGGTG GTTCTTGTGGGGAACAAGTCTGACCTAAAGCAGCTGAGGCAGGTCTCCAAGGAAGAGGGATTGTCTCTGG CTCGAGAATTCAGTTGTCCCTTTTTTGAGACCTCAGCTGCCTACCGTTACTACATCGACGACGTTTTCCA CGCCCTCGTCCGGGAGATCCGTAAGAAAGAGAAGGAGCTAGTACTGGCCATGGAGAAGAAGGCCAAACCC AAGAACAGCGTATGGAAGAGGCTGAAGTCACCGTTCAGGAGGAAGAAAGACTCGGTCACCTGAGTGAAGT GGGCTGTGCTCCTGTGAACTGCAGTGCTCCTTGTGCCTGCTGTGAACTGCAGTGCTCCCCAGTGCAGTCC TGTAATCTGCAGCAGGGAGCACGTCCTCTGCTCTCTGCTATGTGGTTATTCTAAACGTCACTGGCCAGGG GACTCGCCTACTGAGAGCTGTCATTGACTTACTGTCTAAAGCCCTGTGCTCCGTGACTCCCACGCATGAA CTCATCAGGGCCGTGTCTACTCCTTAATTGTCACATTAGAATTTGGTCGGCCATTGTTTTGGTTATGTTG CTGATGTAAATTTGTGTAAATGGTTTCTACCCTGGAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009069 |
Insert Size | 660 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC012694, AAH12694 |
RefSeq Size | 1102 bp |
RefSeq ORF | 660 bp |
Locus ID | 19769 |
UniProt ID | P70426 |
Gene Summary | Plays a crucial role in coupling NGF stimulation to the activation of both EPHB2 and MAPK14 signaling pathways and in NGF-dependent neuronal differentiation. Involved in ELK1 transactivation through the Ras-MAPK signaling cascade that mediates a wide variety of cellular functions, including cell proliferation, survival, and differentiation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202495 | Rit1 (tGFP-tagged) - Mouse Ras-like without CAAX 1 (Rit1) |
CNY 2850.00 |
|
MR202495 | Rit1 (Myc-DDK-tagged) - Mouse Ras-like without CAAX 1 (Rit1), transcript variant 1 |
CNY 2400.00 |
|
MR202495L3 | Lenti ORF clone of Rit1 (Myc-DDK-tagged) - Mouse Ras-like without CAAX 1 (Rit1), transcript variant 1 |
CNY 4750.00 |
|
MR202495L4 | Lenti ORF clone of Rit1 (mGFP-tagged) - Mouse Ras-like without CAAX 1 (Rit1), transcript variant 1 |
CNY 4750.00 |