Park7 (NM_020569) Mouse Untagged Clone

CAT#: MC205599

Park7 (untagged) - Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7), (10ug)



  "NM_020569" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms DJ-1; Dj1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002187
CGGACTAGCGGTGGCTTCGCGTGGGTGGAGGAGGCGCGGCTGCAGTCTTTAAGAAATAGAAATGGCTTCC AAAAGAGCTCTGGTCATCCTGGCCAAAGGAGCAGAGGAGATGGAGACAGTGATTCCTGTGGATGTCATGC GGCGAGCCGGGATTAAAGTCACTGTTGCAGGCTTGGCTGGGAAGGACCCCGTGCAGTGTAGCCGTGATGT AATGATTTGTCCAGATACCAGTCTGGAAGATGCAAAAACGCAGGGACCATACGATGTGGTGGTTCTTCCA GGAGGAAATCTGGGTGCACAGAATTTATCTGAGTCGCCTATGGTGAAGGAGATCCTCAAGGAGCAGGAGA GCAGGAAGGGCCTCATAGCTGCCATCTGTGCAGGTCCTACGGCTCTGTTGGCTCACGAAGTAGGTTTTGG ATGCAAGGTCACAACACACCCACTGGCTAAGGACAAAATGATGAATGGCAGTCACTACAGCTACTCAGAG AGCCGCGTGGAGAAGGACGGCCTGATCCTCACCAGCCGCGGGCCGGGGACCAGCTTTGAGTTTGCACTAG CCATTGTGGAGGCACTCGTGGGGAAAGACATGGCCAACCAAGTGAAGGCACCGCTTGTTCTCAAAGACTA GAGCCCAAGCCCTGGGCCCCACGCTTGAGCAGGCATTGGAAGCCCACTGGTGTGTCCAGAGCCCAGGGAA CCTCAGCAGTAGTATGTGAAGCAGCCGCCACACGGGGCTCTCATCCCGGGTCTGTATGTTTCTGAACCTT GCTAGTAGAATAAACAGTTTACCAAGCTCCTGCCAGCTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_020569
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002187, AAH02187
RefSeq Size 823 bp
RefSeq ORF 570 bp
Locus ID 57320
UniProt ID Q99LX0
Gene Summary Protein and nucleotide deglycase that catalyzes the deglycation of the Maillard adducts formed between amino groups of proteins or nucleotides and reactive carbonyl groups of glyoxals. Thus, functions as a protein deglycase that repairs methylglyoxal- and glyoxal-glycated proteins, and releases repaired proteins and lactate or glycolate, respectively. Deglycates cysteine, arginine and lysine residues in proteins, and thus reactivates these proteins by reversing glycation by glyoxals. Acts on early glycation intermediates (hemithioacetals and aminocarbinols), preventing the formation of advanced glycation endproducts (AGE) that cause irreversible damage. Also functions as a nucleotide deglycase able to repair glycated guanine in the free nucleotide pool (GTP, GDP, GMP, dGTP) and in DNA and RNA. Is thus involved in a major nucleotide repair system named guanine glycation repair (GG repair), dedicated to reversing methylglyoxal and glyoxal damage via nucleotide sanitization and direct nucleic acid repair (By similarity). Also displays an apparent glyoxalase activity that in fact reflects its deglycase activity (PubMed:22523093). Plays an important role in cell protection against oxidative stress and cell death acting as oxidative stress sensor and redox-sensitive chaperone and protease; functions probably related to its primary function (PubMed:15784737, PubMed:17015834, PubMed:20800516, PubMed:21068725). It is involved in neuroprotective mechanisms like the stabilization of NFE2L2 and PINK1 proteins, male fertility as a positive regulator of androgen signaling pathway as well as cell growth and transformation through, for instance, the modulation of NF-kappa-B signaling pathway (PubMed:17015834, PubMed:21097510). Eliminates hydrogen peroxide and protects cells against hydrogen peroxide-induced cell death (PubMed:17766438). Required for correct mitochondrial morphology and function as well as for autophagy of dysfunctional mitochondria (PubMed:20186336). Plays a role in regulating expression or stability of the mitochondrial uncoupling proteins SLC25A14 and SLC25A27 in dopaminergic neurons of the substantia nigra pars compacta and attenuates the oxidative stress induced by calcium entry into the neurons via L-type channels during pacemaking (PubMed:21068725). Regulates astrocyte inflammatory responses, may modulate lipid rafts-dependent endocytosis in astrocytes and neuronal cells (PubMed:23847046, PubMed:19276172). In pancreatic islets, involved in the maintenance of mitochondrial reactive oxygen species (ROS) levels and glucose homeostasis in an age- and diet dependent manner (PubMed:22611253). Protects pancreatic beta cells from cell death induced by inflammatory and cytotoxic setting (PubMed:26422139). Binds to a number of mRNAs containing multiple copies of GG or CC motifs and partially inhibits their translation but dissociates following oxidative stress (By similarity). Metal-binding protein able to bind copper as well as toxic mercury ions, enhances the cell protection mechanism against induced metal toxicity (PubMed:23792957). In macrophages, interacts with the NADPH oxidase subunit NCF1 to direct NADPH oxidase-dependent ROS production, and protects against sepsis (PubMed:26021615).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...