Cst10 (NM_021405) Mouse Untagged Clone
CAT#: MC205550
Cst10 (untagged) - Mouse cystatin 10 (chondrocytes) (Cst10), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | DD72 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC048364
TTTCTTCTCTGCTCCTCTAAAGCTTCATCAACCATGGCAAGTTTGCTGAGCCCCTCGATGCCTGTGTTGG CTGCTGTGGCCTTGACACTGACCCTGGCTGTGATCCCTGAAGCCAGTACTAATGCTGAAGCCAAGCAGGT GGTATTAGGTGGAGTGGAGCCAGCTGACCCTAAGGATAAGGAGGTGCAGAAAGTGGTAAAGTTTGCTGTT AGAACCTACAATGATATGGACAATGACCTGTATCTTAGCAAGCCAATACGACTGATGAGCGCCAGCCAGC AGGTTGTGGCTGGGAAGAACTACTACTTGAAAATTGAGCTAGGCCGAACCACATGTACCAAAACTGAGTC TAATTTGGTTGATTGTCCCTTCAATGAACAGCCAGATCAGCAGAAGAGGGTCATCTGTAATTTCCAGATC AACGTTGCACCTTGGCTGAACAAGATGTCCATGACAAACTTCAACTGTTACAATTTCTGAGGATATATGT CAGGCTACACTTCTGCTGATTGTCTCTTACTTTTACTCAATCTTATCCTTAAGTTCTCCTTTCCTCAGAC AGAGATCTTAGTCCCAAAGGTTGTCTCTTGAGAATGATAGCACCAAGAGAAAAGTAGAGATAGGCCCTGC ACACCTAAGTGACAGTTCCCTTGTTCCTTTCATCTACTTGTTTTTCAAAGGCCCACTGTTCATTATTTGC TCAATAAAAAAATAGCCATAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_021405 |
Insert Size | 447 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC048364, AAH48364 |
RefSeq Size | 740 bp |
RefSeq ORF | 447 bp |
Locus ID | 58214 |
UniProt ID | Q9JM84 |
Gene Summary | May play a role in the last steps of the chondrocyte differentiation pathway as an inducer of maturation (PubMed:13679380). Induces chondrocyte calcification during endochondral ossification by playing a role in the transcriptional inhibition of ENPP1, a generator of pyrophosphate which inhibits calcification (PubMed:16680148). Possibly impairs the binding of a transcription factor to the ENPP1 promoter (PubMed:16680148). Unlike other cystatins, does not have thiol protease inhibitor activity (PubMed:16680148).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201025 | Cst10 (Myc-DDK-tagged) - Mouse cystatin 10 (chondrocytes) (Cst10) |
CNY 1200.00 |
|
MR201025L3 | Lenti ORF clone of Cst10 (Myc-DDK-tagged) - Mouse cystatin 10 (chondrocytes) (Cst10) |
CNY 4750.00 |
|
MR201025L4 | Lenti ORF clone of Cst10 (mGFP-tagged) - Mouse cystatin 10 (chondrocytes) (Cst10) |
CNY 4750.00 |