Itgb3bp (NM_026348) Mouse Untagged Clone
CAT#: MC205135
Itgb3bp (untagged) - Mouse integrin beta 3 binding protein (beta3-endonexin) (Itgb3bp), (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 4930471O16Rik; AU022583 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC049557
GCGGTTTCTCAGTTGGTTCTGTCCAGCAACGGAGTCCCGAAATGCCAGTTAAAAGATCACTGAAACTGGA TGATCAGTTTGAAAAAAATTCATTTAGTCCTTCAAAAATCGTGAGGAAGAAAAGTATTACAGCTTATTCT CCTACTACTGGAACTTATCAGTTGAGCCCATTTTCTTCTCCCGCAACCCCCAAAGAACAGGAGCACAGAA ACGGACCATCAAATGAAACAAGGAAACGGAGTAACTTGAGCTCACCTGTAAGACAGGAGTCCACAGTGAA AGACAGGGATGGATTCATGGTGTTGCTATCTAAAATTGAGATATCATCAGAGAAAACCATGGAGATAATG AAAAATCTAAGTAGTATACAGGCTTTGGAGGGCAACAGACAACTTGAAGATCTCATTGGTGTTTCCCTAG TACCATGCTCCTTAAAAAGTGAAGCAAGGAAAACCAAAGAACTAATGACTAAAGTAATAAAACAAAAGTT GTTTGAAAAGAAAAAATCAAGAATTACTCCCAAAGATCATCATCTTGACAGCTTTGAATTCCTTAAAGCC ATTTTGAACTGAGTGTTACCTTCAAGTCTGACAACTGTCAACCTACCTGGATACTAGTCAAGCCGTAAGA ATGCAGACCAGCCTGAAGTAAAGAGTCAGTGAAAGACTGTCACATTTGCAACCTTTCTTAAAAGACGATA TGCTGAGTATTCTAAATAGGAAAAAAATAAAGGCATCCACCGTGAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_026348 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC049557, AAH49557 |
RefSeq Size | 854 bp |
RefSeq ORF | 531 bp |
Locus ID | 67733 |
UniProt ID | Q9CQ82 |
Gene Summary | Transcription coregulator that can have both coactivator and corepressor functions. Involved in the coactivation of nuclear receptors for retinoid X (RXRs) and thyroid hormone (TRs) in a ligand-dependent fashion. In contrast, it does not coactivate nuclear receptors for retinoic acid, vitamin D, progesterone receptor, nor glucocorticoid. Acts as a coactivator for estrogen receptor alpha. Acts as a transcriptional corepressor via its interaction with the NFKB1 NF-kappa-B subunit, possibly by interfering with the transactivation domain of NFKB1. Induces apoptosis in breast cancer cells, but not in other cancer cells, via a caspase-2 mediated pathway that involves mitochondrial membrane permeabilization but does not require other caspases. May also act as an inhibitor of cyclin A-associated kinase. Also acts a component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201548 | Itgb3bp (tGFP-tagged) - Mouse integrin beta 3 binding protein (beta3-endonexin) (Itgb3bp) |
CNY 2850.00 |
|
MR201548 | Itgb3bp (Myc-DDK-tagged) - Mouse integrin beta 3 binding protein (beta3-endonexin) (Itgb3bp) |
CNY 2400.00 |
|
MR201548L3 | Lenti ORF clone of Itgb3bp (Myc-DDK-tagged) - Mouse integrin beta 3 binding protein (beta3-endonexin) (Itgb3bp) |
CNY 4750.00 |
|
MR201548L4 | Lenti ORF clone of Itgb3bp (mGFP-tagged) - Mouse integrin beta 3 binding protein (beta3-endonexin) (Itgb3bp) |
CNY 4750.00 |
其它Itgb3bp产品