Pebp4 (NM_028526) Mouse Untagged Clone
CAT#: MC205119
Pebp4 (untagged) - Mouse phosphatidylethanolamine binding protein 4 (Pebp4), transcript variant 2, (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | PEBP-4 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC048621
ATTCTCTAAGAATTATATAGGTCCTCAATAGCAGTTAACCTTCATCCCATTAGACAAATACTGTGAGGGT ACCCCGAAGGGACCCCTGCCAGCTTCAAAACGGATCAAGATTCCCCAGGAGAGAACAACGGTAGAGAATC TAATGTAAACCTGTTGCCAAGAACTATGACAATGAAGCTGGTCGCAGCAGCACTTTGCTTGAGCCTCCTT GCAGCCGGCCTGTGGGTGGGCCTCTCATTGACAGCTGAGTCCATTGAAGAAGGGAAACCTGGAGGAGAGA AACCTGGAGGAGGGAAACCTGGAGGCAGCGGACGAGGATGTTTTCTCCCACCACTGCCAAAAGAAGATGT TTCACTATGCAGGAACCTAGAAGTTTTCTACATGGAGATGGGGAACATCAGCTGTAAAATTGTTCCTAAG TGCAATCTATACAGACAGAAGATCACGGCCTGGCAGGCGCCGATAGTCAAGTTCCACACGGCTTTGGATG TGAGTGAACTGGGTTGGCTGAAGGAGAACGTGGGGCCCTGACTTGCCTTTAGTTCACTTTTCTTGGGAAC TTGGAGGGCCAGGTTTGCAGGAGTCAGGCAGCTATTGCCTGGAGTGGTGGTCAACCTCCCTAATCCTAAT CCTTTATATAGTTCCTCATGTGGTGGTGACTCCCAACCATAAAATTACTTTTTGTTGCTACTTCAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | SfiI-SfiI |
| ACCN | NM_028526 |
| Insert Size | 366 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC048621, AAH48621 |
| RefSeq Size | 724 bp |
| RefSeq ORF | 366 bp |
| Locus ID | 73523 |
| Gene Summary | Promotes AKT phosphorylation, suggesting a possible role in the PI3K-AKT signaling pathway.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks several exons, and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR200587 | Pebp4 (Myc-DDK-tagged) - Mouse phosphatidylethanolamine binding protein 4 (Pebp4), transcript variant 2 |
CNY 1900.00 |
|
| MR200587L3 | Lenti ORF clone of Pebp4 (Myc-DDK-tagged) - Mouse phosphatidylethanolamine binding protein 4 (Pebp4), transcript variant 2 |
CNY 3800.00 |
|
| MR200587L4 | Lenti ORF clone of Pebp4 (mGFP-tagged) - Mouse phosphatidylethanolamine binding protein 4 (Pebp4), transcript variant 2 |
CNY 3800.00 |
