Nenf (NM_025424) Mouse Untagged Clone
CAT#: MC205024
Nenf (untagged) - Mouse neuron derived neurotrophic factor (Nenf), (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110060M21Rik; SCIRP10; Spuf |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC048464
GCTCCTCGCTGTCTATGGCGCGCCCCGCGCCCTGGTGGCGGCTGCGGCTGCTGGCGGCGCTCGTCCTGGC GCTGGCTCTGGTCCCAGTGCCCTCAGCCTGGGCTGGGCAGACGCCGCGCCCCGCAGAGCGCGGGCCCCCG GTGCGGCTCTTCACCGAGGAGGAGCTGGCCCGCTACGGCGGCGAGGAGGAGGATCAGCCCATCTACTTGG CAGTGAAGGGAGTGGTGTTCGATGTCACCTCTGGGAAGGAGTTTTATGGACGAGGAGCCCCCTACAATGC CTTGGCCGGGAAGGACTCCAGCAGAGGTGTGGCCAAGATGTCACTGGATCCAGCAGACCTCACTCACGAC ACTACTGGTCTCACGGCCAAGGAGCTGGAGGCCCTCGATGACGTCTTCAGCAAGGTGTACAAAGCCAAGT ACCCCATTGTTGGCTACACAGCCCGAAGGATCCTCAACGAGGATGGCAGCCCCAACCTGGACTTCAAGCC TGAAGACCAGCCCCATTTTGACATAAAGGACGAATTCTGATGTCTAGCTGAGAAGCAGCCGGTTCTAGGG AGAAGTGAGGGGACAGGAGTTAAGTGTCCCTCGGAACAAGCGGAGGAAGCCTCCGAGTGCCCTGCAGCTG AATAAAGCGAATGTTTAACTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_025424 |
Insert Size | 516 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC048464, AAH48464 |
RefSeq Size | 681 bp |
RefSeq ORF | 516 bp |
Locus ID | 66208 |
UniProt ID | Q9CQ45 |
Gene Summary | Acts as a neurotrophic factor in postnatal mature neurons, enhancing neuronal survival (PubMed:15605373). Promotes cell proliferation and neurogenesis in undifferentiated neural pro-genitor cells at the embryonic stage and inhibits differentiation of astrocyte (PubMed:16547973). Its neurotrophic activity is exerted via MAPK1/ERK2, MAPK3/ERK1 and AKT1/AKT pathways (PubMed:15605373, PubMed:16547973). Neurotrophic activity is enhanced by binding to heme (PubMed:18056703). Acts also as an anorexigenic neurotrophic factor that contributes to energy balance (PubMed:23576617).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201443 | Nenf (Myc-DDK-tagged) - Mouse neuron derived neurotrophic factor (Nenf) |
CNY 2400.00 |
|
MR201443L3 | Lenti ORF clone of Nenf (Myc-DDK-tagged) - Mouse neuron derived neurotrophic factor (Nenf) |
CNY 4750.00 |
|
MR201443L4 | Lenti ORF clone of Nenf (mGFP-tagged) - Mouse neuron derived neurotrophic factor (Nenf) |
CNY 4750.00 |