Sln (NM_025540) Mouse Untagged Clone
CAT#: MC204674
Sln (untagged) - Mouse sarcolipin (Sln), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310045A07Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028496
TGGAGGTGGAGAGACTGAGGTCCTTGGTAGCCTGAGTGTGCCCCTGCTCCTCTTCAGGAAGTGAAGACAA GCCTTGGTGTGCAATCACAAGTCCTTCTGGAGTTCTCATCCAGACATTCTGAAGATGGAGAGGTCTACTC AGGAGCTGTTTATCAACTTCACAGTTGTCCTCATCACCGTTCTCCTTATGTGGCTCCTCGTGAGGTCCTA CCAATACTGAGGGGCCATGCTATACTCCAGGGAGTGACTGCTGTGTGCCCCGAGCTTCCAATGCTCTATT GTCATGAGATGCTGCTTCTGGCTCCTCCAGCATCTCTGACCCACACTCACAATGCCTGACACACCGCTGC ACTAGGTCCTTGGCATGTTTTCTAAAGATGCTGTTCTTGTAGGCTGCCCAAAGCTTGCCAGCCAGTGAGC CTTAGCTTTGTTCCCTAGCAAATGTACTATTCAAGTCACCAGGTTAAAATTAAACTGGATTCTTATGATG CAGAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_025540 |
Insert Size | 96 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC028496, AAH28496 |
RefSeq Size | 530 bp |
RefSeq ORF | 96 bp |
Locus ID | 66402 |
UniProt ID | Q9CQD6 |
Gene Summary | Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. This gene encodes a small proteolipid that regulates several sarcoplasmic reticulum Ca(2+)-ATPases. The transmembrane protein interacts with Ca(2+)-ATPases and reduces the accumulation of Ca(2+) in the sarcoplasmic reticulum without affecting the rate of ATP hydrolysis. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200004 | Sln (tGFP-tagged) - Mouse sarcolipin (Sln) |
CNY 2800.00 |
|
MR200004 | Sln (Myc-DDK-tagged) - Mouse sarcolipin (Sln) |
CNY 1200.00 |
|
MR200004L3 | Lenti ORF clone of Sln (Myc-DDK-tagged) - Mouse sarcolipin (Sln) |
CNY 3600.00 |
|
MR200004L4 | Lenti ORF clone of Sln (mGFP-tagged) - Mouse sarcolipin (Sln) |
CNY 3600.00 |