Ybx1 (NM_011732) Mouse Untagged Clone

CAT#: MC204526

Ybx1 (untagged) - Mouse Y box protein 1 (Ybx1), (10ug)



  "NM_011732" in other vectors (5)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700102N10Rik; C79409; dbpB; EF1A; MSY1; mYB-1a; Nsep1; YB-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC031472
CGGACGCGTGGGCGGGAGCGGAGAGCGGACCCCAGAGAGCCCTGAGAGCCCCACCGCCGCCGCCGGCCTA GTCACCATCACACCCGGGAGGAGCCGCAGCCGTCGCCGCCGGCCCCAGTCACCATCACCGCAACCATGAG CAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCCCCCGCCGCCGCCCTCAGCGCCGCCGACACCAAGCCC GGCTCCACGGGCAGCGGCGCGGGTAGTGGCGGCCCGGGTGGCCTCACATCGGCGGCGCCCGCCGGCGGGG ACAAGAAGGTCATCGCAACGAAGGTTTTGGGAACAGTCAAATGGTTCAATGTAAGGAACGGATACGGTTT CATCAACAGGAATGACACCAAGGAAGACGTATTTGTACACCAGACTGCCATAAAGAAGAATAACCCCAGG AAGTACCTTCGCAGTGTAGGCGATGGAGAGACTGTGGAGTTTGATGTTGTTGAAGGAGAAAAGGGTGCGG AGGCAGCAAATGTTACAGGCCCTGGTGGAGTTCCAGTTCAAGGCAGTAAATACGCAGCAGACCGTAACCA TTATAGACGTTATCCACGTCGTAGGGGTCCTCCACGCAATTACCAGCAAAATTACCAGAATAGTGAGAGT GGGGAAAAGAACGAGGGATCGGAAAGCGCTCCTGAAGGCCAGGCCCAACAACGCCGGCCCTATCGCAGGC GAAGGTTCCCACCTTACTACATGCGGAGACCCTATGCGCGTCGACCACAGTATTCCAACCCCCCTGTGCA AGGAGAAGTGATGGAGGGTGCTGACAACCAGGGTGCAGGAGAGCAAGGTAGACCAGTGAGACAGAATATG TATCGGGGTTACAGACCACGATTCCGAAGGGGCCCTCCTCGCCAAAGACAGCCTAGAGAGGATGGCAATG AAGAGGACAAAGAAAATCAAGGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTATCGCCGAAA CTTCAATTACCGACGCAGACGCCCAGAGAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGAT CCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAATGCCGGCTTACCATC TCTACCATCATCCGGTTTGGTCATCCAACAAGAAGAAATGAATATGAAATTCCAGCAATAAGAAATGAAC AAAGATTGGAGCTGAAGACCTTAAGTGCTTGCTTTTTGCCCGCTGACCAGATAACATTAGAACTATCTGC ATTATCTATGCAGCATGGGGTTTTTATTATTTTTACCTAAAGATGTCTCTTTTTGGTAATGACAAACGTG TTTTTTAAGAAAAAAAAAAAAGGCCTGGTTTTTCTCAATACACCTTTAACGGTTTTTAAATTGTTTCATA TCTGGTCAAGTTGAGATTTTTAAGAACTTCATTTTTAATTTGTAATAAAGTTTACAACTTGATTTTTTCA AAAAAGTCAACAAACTGCAAGCCCCTGTTAATAAAGGTCTTAAATAATAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_011732
Insert Size 969 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC031472, AAH31472
RefSeq Size 1562 bp
RefSeq ORF 969 bp
Locus ID 22608
UniProt ID P62960
Gene Summary Mediates pre-mRNA alternative splicing regulation. Component of the CRD-mediated complex that promotes MYC mRNA stability. Binds to splice sites in pre-mRNA and regulates splice site selection. Binds and stabilizes cytoplasmic mRNA. Contributes to the regulation of translation by modulating the interaction between the mRNA and eukaryotic initiation factors. Binds to promoters that contain a Y-box (5'-CTGATTGGCCAA-3'), such as HLA class II genes. Regulates the transcription of numerous genes. Promotes separation of DNA strands that contain mismatches or are modified by cisplatin. Has endonucleolytic activity and can introduce nicks or breaks into double-stranded DNA (in vitro). May play a role in DNA repair. Its transcriptional activity on the multidrug resistance gene MDR1 is enhanced in presence of the APEX1 acetylated form at 'Lys-6' and 'Lys-7'. Binds preferentially to 5'-[CU]CUGCG-3' motif in vitro (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...