Ccdc28b (NM_025455) Mouse Untagged Clone
CAT#: MC204500
Ccdc28b (untagged) - Mouse coiled coil domain containing 28B (Ccdc28b), (10ug)
CNY 2400.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | 1110002E08Rik; 1810010N17Rik | 
| Vector | PCMV6-Kan/Neo | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >BC028873 
GCTCCAGTTCCCCTGAGGAGAGAGAAAGCAGGGTGAAGGGAGATTGCAAAGAAGCACTGTTTTACACTCC AGACCCCAAACTTCCAGACCTGAGGTCCAACACACCACCCAATGGAAGACAAAAAGAAGAAACGGAGTCC TAAGCCCTGCCTGACCCAACAAGCACAGGCCCCAGGCACACTGCGCAGAGTCCCTGTGCCCACCAGCCAC AGTGGCTCCTTGGCTCTGGGACTCCCTCATTTGCCATCACCTAAGCAGCGAGCCAAGTTCAAGAGAGCAG GCAAGGAGAAATGCCGACCGGTGCTGGCTGGAGGTGGAGGCGGCTCCGCAGGCACACCCCTGCAACACTC CTTCCTGACAGAGGTGACAGATGTTTATGAGATGGAGGGAGGACTGCTGAACTTGCTCAATGATTTTCAT TCAGGCCGCCTGCAGGCCTTTGGGAAGGAATGTTCCTTCGAGCAGCTGGAGCATGTTCGGGAGATGCAGG AGAAGTTGGCCAGACTGCACTTCAGCCTGGATGTGTGTGGGGAGGAAGAGGACGAGGAAGAAGAGGAGGA TGGGGTCACAGAAGGCTTGCCTGAGGAGCAGAAGAAGACAATGGCTGACCGCAACCTGGACCAGCTGCTT AGCAATCTGGAAGATCTTAGCAATTCCATACAGAAGCTACACTTGGCAGAGAATGCTGAGCCTGAGGACC AGCCAGCTGCGTAGGTGTCGCCTAAACTCTTCTGCTACTCTCCTCTTCAAACTGTGAATTTTACGGATTC GGAAGCCCCTTGGTGCTATGGGGTCGGGGGCACTGGTTGGAATTAAACAAACAGAAAAGCGAAAAAAAAA AAAAAAAAAA  | 
        
| Restriction Sites | RsrII-NotI | 
| ACCN | NM_025455 | 
| Insert Size | 603 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | BC028873, AAH28873 | 
| RefSeq Size | 850 bp | 
| RefSeq ORF | 603 bp | 
| Locus ID | 66264 | 
| UniProt ID | Q8CEG5 | 
| Gene Summary | Involved in ciliogenesis. Regulates cilia length through its interaction with MAPKAP1/SIN1 but independently of mTORC2 complex. Modulates mTORC2 complex assembly and function, possibly enhances AKT1 phosphorylation. Does not seem to modulate assembly and function of mTORC1 complex.[UniProtKB/Swiss-Prot Function] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG202023 | Ccdc28b (tGFP-tagged) - Mouse coiled coil domain containing 28B (Ccdc28b) | 
                                                     CNY 2850.00  | 
                                            |
| MR202023 | Ccdc28b (Myc-DDK-tagged) - Mouse coiled coil domain containing 28B (Ccdc28b) | 
                                                     CNY 2400.00  | 
                                            |
| MR202023L3 | Lenti ORF clone of Ccdc28b (Myc-DDK-tagged) - Mouse coiled coil domain containing 28B (Ccdc28b) | 
                                                     CNY 4750.00  | 
                                            |
| MR202023L4 | Lenti ORF clone of Ccdc28b (mGFP-tagged) - Mouse coiled coil domain containing 28B (Ccdc28b) | 
                                                     CNY 4750.00  | 
                                            
其它Ccdc28b产品
