Gtf3a (NM_025652) Mouse Untagged Clone
CAT#: MC204444
Gtf3a (untagged) - Mouse general transcription factor III A (Gtf3a), (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2010015D03Rik; 2610111I01Rik; 5330403M05Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC032292
CCACGCGTCCGCCTTCATCAGAGACTACCATCTGAGCCGGCATGTCCTGATTCACACCGGGGAAAAGCCG TTTGTTTGTGCAGATGATGGCTGTAATCAGAAATTCAACACAAAATCAAACTTGAAGAAACACATTGAAC GCAAACATGGAAACCCACAAAAACAGTATGTGTGCAGTTATGAGGGTTGCAAGAAGGCCTTTAAGAAGCA CCAGCAGCTGAGAACCCATCAGTGCCAGCACACCAGCGAGCCACTCTTCAGGTGTACCCACGAGGGATGC GGGAAGCACTTTGCCTCGCCCAGCAGGCTGAAACGGCATGGGAAAGTTCACGAGGGCTACCTGTGTCAAA AGGGATGTTCTTTCATGGGAAAAACGTGGACAGAGCTTCTGAAACACATGAGAGAAGCCCATAAAGAGGA CATAACCTGCAACGTATGTCAGAGGATGTTCAAGCGCAGAGATTACCTTAAGCAGCACATGAAGACTCAC GCCCCGGAAAGGGATGTGTACCGCTGTCCGCGGCAAGGCTGCGGAAGAACCTACACAACCGTGTTCAACC TGCAGAGCCACATTCTCTCCTTCCACGAGGAAAAGCGCCCATTTGTGTGTGAGCACGCTGGCTGTGGCAA GACATTCGCAATGAAACAGAGTCTCATGAGGCACAGTGTCGTGCACGATCCCGACAAGAAGAGGATGAAG CTCAAAGTAAGAGCCCCTCGGGAGAGACGCAGCTTGGCCTCTCGCCTCAGTGGGTACTTCCCTCCTAAGA GGAAACAAGAGCCCGACTACTCCTTGCCTAACGCCAGCGCAGAGTCCAGCAGCAGTCCAGAGGCCCAGCT GCCCCCGCCAGCCACCTTACTCACTGTCTGCTAGGCGGGAAGACTTCAGGGCGGCCGGCAGAGGCTCCTG GCCTGCACTTTTCCTATTAAAGTCACTGACACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025652 |
Insert Size | 510 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC032292, AAH32292 |
RefSeq Size | 996 bp |
RefSeq ORF | 510 bp |
Locus ID | 66596 |
UniProt ID | Q8VHT7 |
Gene Summary | The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223388 | Gtf3a (tGFP-tagged) - Mouse general transcription factor III A (Gtf3a), (10ug) |
CNY 3990.00 |
|
MR223388 | Gtf3a (Myc-DDK-tagged) - Mouse general transcription factor III A (Gtf3a) |
CNY 3610.00 |
|
MR223388L3 | Lenti ORF clone of Gtf3a (Myc-DDK-tagged) - Mouse general transcription factor III A (Gtf3a) |
CNY 5510.00 |
|
MR223388L4 | Lenti ORF clone of Gtf3a (mGFP-tagged) - Mouse general transcription factor III A (Gtf3a) |
CNY 5510.00 |