Cdkn2c (NM_007671) Mouse Untagged Clone

CAT#: MC204135

Cdkn2c (untagged) - Mouse cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (Cdkn2c), (10ug)



  "NM_007671" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C77269; INK; INK4c; p1; p18; p18-INK4c; p18-INK6; p18IN; p18INK4c
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027026
CCCCTCTCCAATGGGCTCACTTTTGCTGAATAATCACGTGTGAATCGAGGGGCGGGCTTTTGGCAGGCCG ACCTTACTAGTATTTACTACCAAGCTCTACTCCAGATTAACCATCCCAGTCCTTCTGTCAGCCTCCGATG CCATCATGCAGCCTGATTAGGAGCAAAGGAAAGGGGAAAAAGAGAAGCAACTAATCGTCTTTTCCCGATC GTCAGGACCCTAAAGAATGGCCGAGCCTTGGGGGAACGAGTTGGCGTCCGCAGCTGCCAGGGGGGACCTA GAGCAACTTACTAGTTTGTTGCAAAATAATGTAAACGTCAACGCTCAAAATGGATTTGGGAGAACTGCGC TGCAGGTTATGAAACTTGGAAATCCGGAGATTGCCAGGAGGCTTCTCCTCAGAGGTGCTAATCCCAATTT GAAAGATGGAACTGGTTTTGCTGTCATTCATGATGCTGCCAGAGCAGGTTTCCTGGACACTGTACAGGCT TTGCTGGAGTTCCAGGCTGATGTTAACATTGAAGATAATGAAGGGAACCTGCCCTTGCACTTGGCTGCCA AAGAAGGCCACCTCCCTGTGGTGGAGTTCCTTATGAAGCACACAGCCTGCAATGTGGGGCATCGGAACCA TAAGGGGGACACCGCCTTCGACTTGGCCAGGTTCTATGGAAGAAATGAGGTCATTAGCCTGATGGAGGCA AATGGGGTTGGGGGAGCCACAAGCCTGCAGTGAATGTGTAGAGGTCTCTCTCACTGACCTCACACTGTCC GTTAGTTGGTTGGCTGTCCGTTTCACTATCACTTATTAAAATATAGGGTTTCCTTTCGCTTTGTTTTCAT ATTTTAAGCAGCCAAATCCTTCAAAACTGCCTAAGTGGAAATCTTACTACAAGTTTATGAAATATTTAAA CTTCTTTTTCACTGTCAAAATTCTGATTTCTAACATGTAATAGCTATTCCTTTTTTTCTGGATATTTTAT CTTTGATTTTTTTTTTCTTTGCTTACCCTTTTTCATTCTCAGTGTCTGACTTGGAGACTTTGTTTTAAAA ATTATTTGTCCTGATGCATCTTTTGCCTAATTAAAACACATTTTTCCAGAAGAGGAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007671
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC027026, AAH27026
RefSeq Size 1119 bp
RefSeq ORF 507 bp
Locus ID 12580
UniProt ID Q60772
Gene Summary The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase (cdk) inhibitors, and contains five ankyrin repeats. This protein interacts with both Cdk4 and Cdk6 to inhibit their kinase activities, and prevent their interactions with D-type cyclins, thereby negatively regulating cell division. This gene is differentially expressed in a variety of tissues, and is cell cycle regulated. Deletion of this gene can lead to tumor growth. Maximal expression is observed at the G2/M phase. Alternative splicing and promoter usage results in multiple transript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2, also known as p18(S)) differs in the 5' UTR and represents use of an alternate promoter, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...