Mrpl14 (NM_026732) Mouse Untagged Clone
CAT#: MC204132
Mrpl14 (untagged) - Mouse mitochondrial ribosomal protein L14 (Mrpl14), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110006I11Rik; AI846816; MRP-L32; Rpml32 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027021
GGCGGGGCCTTGCCAAGCGGGGGTCCGTGGCGGGAGATTCCCAGGCTGTTAACGCGGTTTGCCGTCTTGG GATCCCATGGCCGCCCTTACTGGGCTTTGGGGCTCTTTTGCCCATGTCAGCAGAGCATTCAGCCAGCGCT GCTTCAGCACCTCTGGGAGCCTCAGTGCCGTCCAGAAGATGACTCGGGTCCGAGTAGTGGACAACAGCGC CCTGGGCAGCACCCCATACCATCGGCCACCCCGGTGCATCCACGTCTATAACAAGAGTGGGGTGGGCAAG GTGGGCGACCAGATCCTGCTGGCCATCAGGGGGCAGAAGAAGAAAGCACTCATCGTGGGACACCGCATGC CCGGCTCCCGAATGACCCCAAAGTTTGACTCCAACAACGTGGTCCTCATTGAGGACAATGGCAACCCTGT GGGGACTCGAATTAAAATACCTATCCCGACCAGCCTTCGCAGAAGGGAAGGAGAGTATTCCAAGGTCCTG GCCATCGCTCAGAACTTTGTGTGAGCAGAGCGGCTCTGGGCTCCTGCCACACTGGTGACAGTGTCGTGGA GCAGAATAAATGTTTTAATGTATGTTTTCTTCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_026732 |
| Insert Size | 438 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027021, AAH27021 |
| RefSeq Size | 672 bp |
| RefSeq ORF | 438 bp |
| Locus ID | 68463 |
| UniProt ID | Q9D1I6 |
| Gene Summary | May form part of 2 intersubunit bridges in the assembled ribosome. Upon binding to MALSU1, intersubunit bridge formation is blocked, preventing ribosome formation and repressing translation.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200958 | Mrpl14 (tGFP-tagged) - Mouse mitochondrial ribosomal protein L14 (Mrpl14) |
CNY 2850.00 |
|
| MR200958 | Mrpl14 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein L14 (Mrpl14), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
| MR200958L3 | Lenti ORF clone of Mrpl14 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein L14 (Mrpl14), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
| MR200958L4 | Lenti ORF clone of Mrpl14 (mGFP-tagged) - Mouse mitochondrial ribosomal protein L14 (Mrpl14), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
